Difference between revisions of "Part:BBa K1728016"
Timothykoala (Talk | contribs) (→In vivo assay) |
|||
(3 intermediate revisions by 2 users not shown) | |||
Line 5: | Line 5: | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
− | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. This part, we use | + | Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS) in the loop. There are three basic elements of toehold switches including 30bp trigger sequence (TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(IL8 toehold switch RNA sensor, BBa_K1728000). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019) as our down stream gene and even a highly sensitivity reporter. |
+ | |||
+ | ===In vivo assay=== | ||
+ | https://static.igem.org/mediawiki/2015/9/93/CGU_Taiwan_IL8_in_vivo.png | ||
+ | <br> | ||
+ | We lysed the bacteria to get the lysate. There are two groups, one is toehold switch only; the other is toehold switch treated with trigger, which is made by cotransformation of the two constructed plasmids: BBa_K1728016and BBa_K1728012. The two plasmids can be selected for that they were constructed with different backbones which contains different antibiotics resistance. Thus, the bacteria can survive the environment with ampicillin and chloramphenicol antibiotics added if the two plasmids are successfully cotransformed. | ||
<!-- --> | <!-- --> |
Latest revision as of 01:39, 19 September 2015
IL8 toehold switch RNA sensor with T7 promoter & luciferase reporter
IL8 toehold switch RNA sensor with T7 promoter & luciferase reporter
Usage and Biology
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS) in the loop. There are three basic elements of toehold switches including 30bp trigger sequence (TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene.In order to highly transcribe, we add a T7 promoter sequence in front of the toehold switch sequence(IL8 toehold switch RNA sensor, BBa_K1728000). This part, we use luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019) as our down stream gene and even a highly sensitivity reporter.
In vivo assay
We lysed the bacteria to get the lysate. There are two groups, one is toehold switch only; the other is toehold switch treated with trigger, which is made by cotransformation of the two constructed plasmids: BBa_K1728016and BBa_K1728012. The two plasmids can be selected for that they were constructed with different backbones which contains different antibiotics resistance. Thus, the bacteria can survive the environment with ampicillin and chloramphenicol antibiotics added if the two plasmids are successfully cotransformed.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 922