Difference between revisions of "Part:BBa K1728016"

Line 5: Line 5:
  
 
===Usage and Biology===
 
===Usage and Biology===
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. This part, we use firefly luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene to be a highly sensitivity reporter.
+
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. This part, we use firefly luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.
  
 
<!-- -->
 
<!-- -->

Revision as of 22:52, 18 September 2015

IL8 toehold switch RNA sensor with T7 promoter & luciferase reporter

IL8 toehold switch RNA sensor with T7 promoter & luciferase reporter

Usage and Biology

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp trigger sequence(TAGATGAAGTTGTGAAGTACATAACACACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of Interleukin 8 (IL8) mRNA(IL8 partial sequence, BBa_K1728004). Once the IL8 mRNA is presented, the toehold structure will open. Therefore, the ribosome is able to bind on the RBS and translate the down stream gene. This part, we use firefly luciferase(Firefly luciferase - luciferase from Photinus pyralis, BBa_I712019)as our down stream gene and even a highly sensitivity reporter.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 922