Difference between revisions of "Part:BBa K1796008"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1796008 short</partinfo>
 
<partinfo>BBa_K1796008 short</partinfo>
Line 6: Line 5:
 
We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves&#65288;done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline.
 
We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves&#65288;done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline.
 
Sequence submit is promoted by the synthesis company, containing a PstI in the gene.
 
Sequence submit is promoted by the synthesis company, containing a PstI in the gene.
−
The sequence we promoted: CAGGAGGGAGGAATAGGCCAAATGTCTTCTATCGTTGACAAAGGTAAACAGATCGTTGAAGAAATCCTGGAAGTTTACCCGAAAAAAGCTAAAAAAGACCGTACCAAACACTTCGAAATCGCTGACGAAGAACTGGTTAACTGCGGTACCTGCTCTATCAAATCTAACATGAAATCTCGTCCGGGTGTTATGACCGCTCGTGGTTGCGCTTACGCTGGTTCTAAAGGTGTTGTTTGGGGTCCGATCAAAGACATGGTTCACATCTCTCACGGTCCGATCGGTTGCGGTCAGTACTCTTGGGGTACCCGTCGTAACTACGCTAACGGTATCCTGGGTATCGACAACTTCACCGCTATGCAGATCACCTCTAACTTCCAGGAAAAAGACATCGTTTTCGGTGGTGACAAAAAACTGGAAGTTATCTGCCGTGAAATCAAAGAAATGTTCCCGCTGGCTAAAGGTATCTCTGTTCAGTCTGAATGCCCGGTTGGTCTGATCGGTGACGACATCGGTGCTGTTGCTAAAAAAATGACCGAAGAACTGGGTATCCCGGTTATCCCGGTTCGTTGCGAAGGTTTCCGTGGTGTTTCTCAGTCTCTGGGTCACCACATCGCTAACGACGCTATCCGTGACTTCCTGATGGGTCGTCGTGAACTGAAAGAATGCGGTCCGTACGACGTTTCTATCATCGGTGACTACAACATCGGTGGTGACGCTTGGGCTTCTCGTATCCTGCTGGAAGAAATGGGTCTGCGTGTTATCGCTCAGTGGTCTGGTGACGGTACCATCAACGAACTGGGTATCGCTCACAAATCTAAACTGAACCTGATCCACTGCCACCGTTCTATGAACTACATGTGCACCACCATGGAACAGGAATACGGTATCCCGTGGATGGAATACAACTTCTTCGGTCCGACCAAAACCATGGAATCTCTGCGTGCTATCGCTGCTCGTTTCGACGAAACCATCCAGGAAAAATGCGAACAGGTTATCGCTCAGTACATGCCGCAGATGGAAGCTGTTATCCGTAAATACCGTCCGCGTCTGGAAGGTAAAAAAGTTATGCTGCTGATCGGTGGTCTGCGTGCTCGTCACACCATCGGTGCTTACGAAGACCTGGGTATGGAAATCGTTGCTACCGGTTACGAATTTGCTCACAAAGACGACTACGAAAAAACCTTCCCGGACGTTAAAGAAGGTACCATCCTGTACGACGACCCGACCGCTTACGAACTGGAAGAACTGGCTCAGCGTCTGAACATCGACCTGATGGGTGCTGGTGTTAAAGAAAAATACGTTTACCACAAAATGGGTATCCCGTTCCGTCAGATGCACTCTTGGGACTACTCTGGTCCATACCACGGGTTTGACGGCTTCAAGATCTTCGCGCGTGACATGGACATGACCATCAACTCTCCGGTTTGGTCTCTGCTGCCGTCTCGTCAGACCGCTGAAGTTCCGGTTTAATAA
+
 
  
  
Line 21: Line 20:
 
<partinfo>BBa_K1796008 parameters</partinfo>
 
<partinfo>BBa_K1796008 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
==Parametre of Protein==
 +
<p> Number of amino acids: 1473 </p>
 +
<p> </p>
 +
<p> Molecular weight: 119881.7 </p>
 +
<p> </p>
 +
<p> Theoretical pI: 4.98 </p>
 +
<p> </p>
 +
<p> Amino acid composition: </p>
 +
<p> </p>
 +
<p> Ala (A) 402      27.3% </p>
 +
<p> </p>
 +
<p> Arg (R)  0      0.0% </p>
 +
<p> </p>
 +
<p> Asn (N)  0      0.0% </p>
 +
<p> </p>
 +
<p> Asp (D)  0      0.0% </p>
 +
<p> </p>
 +
<p> Cys (C) 352      23.9% </p>
 +
<p> </p>
 +
<p> Gln (Q)  0      0.0% </p>
 +
<p> </p>
 +
<p> Glu (E)  0      0.0% </p>
 +
<p> </p>
 +
<p> Gly (G) 402      27.3% </p>
 +
<p> </p>
 +
<p> His (H)  0      0.0% </p>
 +
<p> </p>
 +
<p> Ile (I)  0      0.0% </p>
 +
<p> </p>
 +
<p> Leu (L)  0      0.0% </p>
 +
<p> </p>
 +
<p> Lys (K)  0      0.0% </p>
 +
<p> </p>
 +
<p> Met (M)  0      0.0% </p>
 +
<p> </p>
 +
<p> Phe (F)  0      0.0% </p>
 +
<p> </p>
 +
<p> Pro (P)  0      0.0% </p>
 +
<p> </p>
 +
<p> Ser (S)  0      0.0% </p>
 +
<p> </p>
 +
<p> Thr (T) 317      21.5% </p>
 +
<p> </p>
 +
<p> Trp (W)  0      0.0% </p>
 +
<p> </p>
 +
<p> Tyr (Y)  0      0.0% </p>
 +
<p> </p>
 +
<p> Val (V)  0      0.0% </p>
 +
<p> </p>
 +
<p> Pyl (O)  0      0.0% </p>
 +
<p> </p>
 +
<p> Sec (U)  0      0.0% </p>
 +
<p> </p>
 +
<p> (B)  0          0.0% </p>
 +
<p> </p>
 +
<p> (Z)  0          0.0% </p>
 +
<p> </p>
 +
<p> (X)  0          0.0% </p>
 +
<p> </p>
 +
<p> Total number of negatively charged residues (Asp + Glu): 0 </p>
 +
<p> Total number of positively charged residues (Arg + Lys): 0 </p>
 +
<p> </p>
 +
<p> Atomic composition:Carbon      C              4334 </p>
 +
<p> Hydrogen    H        7197 </p>
 +
<p> Nitrogen    N        1473 </p>
 +
<p> Oxygen      O        1791 </p>
 +
<p> Sulfur      S          352 </p>
 +
<p> </p>
 +
<p> Formula: C4334H7197N1473O1791S352Total number of atoms: 15147 </p>
 +
<p> </p>
 +
<p> Extinction coefficients:This protein does not contain any Trp residues. Experience shows that </p>
 +
<p> this could result in more than 10% error in the computed extinction coefficient. </p>
 +
<p> </p>
 +
<p> Extinction coefficients are in units of  M-1 cm-1, at 280 nm measured in water. </p>
 +
<p> </p>
 +
<p> Ext. coefficient    22000 </p>
 +
<p> Abs 0.1% (=1 g/l)  0.184, assuming all pairs of Cys residues form cystines </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> Ext. coefficient        0 </p>
 +
<p> Abs 0.1% (=1 g/l)  0.000, assuming all Cys residues are reduced </p>
 +
<p> </p>
 +
<p> Estimated half-life:The N-terminal of the sequence considered is C (Cys). </p>
 +
<p> </p>
 +
<p> The estimated half-life is: 1.2 hours (mammalian reticulocytes, in vitro). </p>
 +
<p>                             >20 hours (yeast, in vivo). </p>
 +
<p>                             >10 hours (Escherichia coli, in vivo). </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> Instability index:The instability index (II) is computed to be 40.53 </p>
 +
<p> This classifies the protein as unstable. </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> </p>
 +
<p> Aliphatic index: 27.29 </p>
 +
<p> </p>
 +
<p> Grand average of hydropathicity (GRAVY): 0.829 </p>

Revision as of 21:12, 18 September 2015

nifD promoted from Paenibacillus sp. WLY78

Function: αsubunits of dinitrogease which also called FeMo protein. NifD encode a metallocluster: FeMo-co, a [Mo-7Fe-9S-C-homocitrate] cluster which serves as the active site of substrate binding and reduction. We abtained the sequences from genomes of Paenibacillus sp. WLY78. First, we promoted it ourselves（done by Nan Wang and Nannan Xie).Then we sent the sequences to synthesis, but unfortunately, striction enzyme cut site was involved after they promoted it again. But we were not informed of the error in promotion.After several times failed expriments, we found the problem.We tackled them over the matter, mistakes were corrected, but the correct genes can't arrive on time,it can only arrive after the deadline. Sequence submit is promoted by the synthesis company, containing a PstI in the gene.


Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 150
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 150
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1116
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 150
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 150
    Illegal AgeI site found at 1141
  • 1000
    COMPATIBLE WITH RFC[1000]


Parametre of Protein

Number of amino acids: 1473

Molecular weight: 119881.7

Theoretical pI: 4.98

Amino acid composition:

Ala (A) 402 27.3%

Arg (R) 0 0.0%

Asn (N) 0 0.0%

Asp (D) 0 0.0%

Cys (C) 352 23.9%

Gln (Q) 0 0.0%

Glu (E) 0 0.0%

Gly (G) 402 27.3%

His (H) 0 0.0%

Ile (I) 0 0.0%

Leu (L) 0 0.0%

Lys (K) 0 0.0%

Met (M) 0 0.0%

Phe (F) 0 0.0%

Pro (P) 0 0.0%

Ser (S) 0 0.0%

Thr (T) 317 21.5%

Trp (W) 0 0.0%

Tyr (Y) 0 0.0%

Val (V) 0 0.0%

Pyl (O) 0 0.0%

Sec (U) 0 0.0%

(B) 0 0.0%

(Z) 0 0.0%

(X) 0 0.0%

Total number of negatively charged residues (Asp + Glu): 0

Total number of positively charged residues (Arg + Lys): 0

Atomic composition:Carbon C 4334

Hydrogen H 7197

Nitrogen N 1473

Oxygen O 1791

Sulfur S 352

Formula: C4334H7197N1473O1791S352Total number of atoms: 15147

Extinction coefficients:This protein does not contain any Trp residues. Experience shows that

this could result in more than 10% error in the computed extinction coefficient.

Extinction coefficients are in units of M-1 cm-1, at 280 nm measured in water.

Ext. coefficient 22000

Abs 0.1% (=1 g/l) 0.184, assuming all pairs of Cys residues form cystines

Ext. coefficient 0

Abs 0.1% (=1 g/l) 0.000, assuming all Cys residues are reduced

Estimated half-life:The N-terminal of the sequence considered is C (Cys).

The estimated half-life is: 1.2 hours (mammalian reticulocytes, in vitro).

>20 hours (yeast, in vivo).

>10 hours (Escherichia coli, in vivo).

Instability index:The instability index (II) is computed to be 40.53

This classifies the protein as unstable.

Aliphatic index: 27.29

Grand average of hydropathicity (GRAVY): 0.829