Difference between revisions of "Part:BBa K1723004:Design"

 
(Design Notes)
 
(6 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1723004 short</partinfo>
 
<partinfo>BBa_K1723004 short</partinfo>
Line 7: Line 6:
  
 
===Design Notes===
 
===Design Notes===
This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [3] and the specific sequence for the gRNA Z35 was designed from the sequence of the plasmid pWJ89 D.Bikard [1] sent us.
+
This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [2] and the specific sequence for the gRNA Z35 was designed from the sequence of the PAM rich URS J23117 promoter (BBa_K1723001) of the plasmid pWJ89 D.Bikard [1] sent us.
 
+
  
 +
this part contains deletions comparing to the original design, the 92nd base of the promoter and the 27th base of the terminator are missing. The original sequence for pBAD promoter is: GGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATA GCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATA, and the original sequence of the terminator is: ATTGCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT. All of our tests were performed with the deletions and it didn't affect the sgRNA function.
  
 
===Source===
 
===Source===
Line 16: Line 15:
  
 
===References===
 
===References===
 +
[1] Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., & Marraffini, L. A. (2013). Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic acids research, 41(15), 7429-7437.
 +
 +
[2] Alec AK Nielsen & Christopher A Voigt (2014). Multi-input CRISPR/Cas circuits that interface host regulatory network. Molecular systems biology, 10(11), 763.

Latest revision as of 17:55, 18 September 2015

sgRNA Z35 expressing cassette


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 178
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 125
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [2] and the specific sequence for the gRNA Z35 was designed from the sequence of the PAM rich URS J23117 promoter (BBa_K1723001) of the plasmid pWJ89 D.Bikard [1] sent us.

this part contains deletions comparing to the original design, the 92nd base of the promoter and the 27th base of the terminator are missing. The original sequence for pBAD promoter is: GGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATA GCATTTTTATCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATA, and the original sequence of the terminator is: ATTGCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT. All of our tests were performed with the deletions and it didn't affect the sgRNA function.

Source

this part was fully synthesized.

References

[1] Bikard, D., Jiang, W., Samai, P., Hochschild, A., Zhang, F., & Marraffini, L. A. (2013). Programmable repression and activation of bacterial gene expression using an engineered CRISPR-Cas system. Nucleic acids research, 41(15), 7429-7437.

[2] Alec AK Nielsen & Christopher A Voigt (2014). Multi-input CRISPR/Cas circuits that interface host regulatory network. Molecular systems biology, 10(11), 763.