Difference between revisions of "Part:BBa K1603004:Design"
(→Design Notes) |
(→Source) |
||
Line 26: | Line 26: | ||
===Source=== | ===Source=== | ||
− | Sequence adapted from Deinococcus | + | Sequence adapted from ''Deinococcus radiodurans''. Ordered as synthetic gene. |
===References=== | ===References=== |
Latest revision as of 14:34, 18 September 2015
SSB - optimized for yeast
- 10INCOMPATIBLE WITH RFC[10]Illegal PstI site found at 248
- 12INCOMPATIBLE WITH RFC[12]Illegal PstI site found at 248
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 111
Illegal XhoI site found at 875 - 23INCOMPATIBLE WITH RFC[23]Illegal PstI site found at 248
- 25INCOMPATIBLE WITH RFC[25]Illegal PstI site found at 248
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 482
Design Notes
Synthetic gene ordered from IDT.
Codon optimized for Saccharomyces cerevisiae and fused with a nuclear localization signal (NLS) for in vivo DNA repair. Also fused with a His-tag, allowing nickel based purification prior in vitro DNA repair
Primers for amplification with BioBrick Prefix in the FW primer and Suffix in the RV primer:
FW:GCTTCTAGATGTCTCATAGACATCACCATCAC
RV:AGCCTGCAGCGGCCGCTACTAGTATTAAAAGGGTAAATCATCTTCTTCTG
The primers were designed to remove the EcoRI site from the insert when constructing the biobrick to reduce the amount of base pairs in the primers. The primers also add 3 extra protective basepairs to the PstI site in the insert.
The construction of the final biobrick was initiated by cutting BBa_J04450 with XbaI, PstI, KnpI and FastAP and the insert with XbaI and PstI.
Source
Sequence adapted from Deinococcus radiodurans. Ordered as synthetic gene.