Difference between revisions of "Part:BBa K1603003:Design"
(→Design Notes) |
(→Source) |
||
(3 intermediate revisions by the same user not shown) | |||
Line 9: | Line 9: | ||
Synthetic gene ordered from IDT. | Synthetic gene ordered from IDT. | ||
− | Codon optimized for | + | Codon optimized for ''Saccharomyces cerevisiae'' and fused with a nuclear localization signal (NLS) for in vivo DNA repair. Also fused with a His-tag, allowing nickel based purification prior in vitro DNA repair |
+ | |||
+ | |||
+ | Primers for amplification with BioBrick Prefix in the FW primer and Suffix in the RV primer: | ||
+ | |||
+ | FW:GCTTCTAGATGTCTCATAGACATCACCATCAC | ||
+ | |||
+ | RV:AGCCTGCAGCGGCCGCTACTAGTATTAAGCTTCTGCGGCTTCA | ||
+ | |||
+ | |||
+ | The primers were designed to remove the EcoRI site from the insert when constructing the biobrick to reduce the amount of base pairs in the primers. The primers also add 3 extra protective basepairs to the PstI site in the insert. | ||
+ | |||
+ | |||
+ | The construction of the final biobrick was initiated by cutting [https://parts.igem.org/Part:BBa_J04450 BBa_J04450] with XbaI, PstI, KnpI and FastAP and the insert with XbaI and PstI. | ||
===Source=== | ===Source=== | ||
− | Sequence adapted from Deinococcus | + | Sequence adapted from ''Deinococcus radiodurans''. Ordered as synthetic gene. |
===References=== | ===References=== |
Latest revision as of 14:33, 18 September 2015
RecA - optimized for yeast
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 260
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 1116
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1032
Design Notes
Synthetic gene ordered from IDT.
Codon optimized for Saccharomyces cerevisiae and fused with a nuclear localization signal (NLS) for in vivo DNA repair. Also fused with a His-tag, allowing nickel based purification prior in vitro DNA repair
Primers for amplification with BioBrick Prefix in the FW primer and Suffix in the RV primer:
FW:GCTTCTAGATGTCTCATAGACATCACCATCAC
RV:AGCCTGCAGCGGCCGCTACTAGTATTAAGCTTCTGCGGCTTCA
The primers were designed to remove the EcoRI site from the insert when constructing the biobrick to reduce the amount of base pairs in the primers. The primers also add 3 extra protective basepairs to the PstI site in the insert.
The construction of the final biobrick was initiated by cutting BBa_J04450 with XbaI, PstI, KnpI and FastAP and the insert with XbaI and PstI.
Source
Sequence adapted from Deinococcus radiodurans. Ordered as synthetic gene.