Difference between revisions of "Part:BBa K1795002"

Line 3: Line 3:
  
 
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence  atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.  
 
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence  atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.  
 +
 +
 +
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===

Revision as of 00:52, 18 September 2015

R0010 gRNA under R0040

This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]