Difference between revisions of "Part:BBa K1795002"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
−
<partinfo>BBa_K1795001 short</partinfo>
+
<partinfo>BBa_K1795002 short</partinfo>
  
 
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence  atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.  
 
This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence  atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.  

Revision as of 00:46, 18 September 2015

R0010 gRNA under R0040

This sgRNA sequence was designed to target the Promoter Bba_R0010 with the N20 sequence atgttgtgtggaattgtgag . If this gRNA is expressed in a cell with a form of the dCas9 protein, the protein will be targeted to the N20 sequence and repress gene expression. The part is under the control of the promoter Bba_R0040. Promoter Bba_R0040 was chosen because it does not contain a PAM and therefore cannot be inadvertently repressed by dCas9 due to unintentional homology in the N20 sequence. Expression of this part can be repressed if TetR is expressed in the cell without Tetracycline present. If TetR and Tetracycline (or its analog aTc) are both present, the part will be expressed.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Illegal PstI site found at 1016
    Illegal PstI site found at 2642
    Illegal PstI site found at 3884
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal PstI site found at 1016
    Illegal PstI site found at 2642
    Illegal PstI site found at 3884
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1216
    Illegal BglII site found at 1272
    Illegal BglII site found at 1414
    Illegal BglII site found at 1962
    Illegal BglII site found at 3802
    Illegal BglII site found at 4041
    Illegal BamHI site found at 3604
    Illegal BamHI site found at 3965
  • 23
    INCOMPATIBLE WITH RFC[23]
    Illegal PstI site found at 1016
    Illegal PstI site found at 2642
    Illegal PstI site found at 3884
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal PstI site found at 1016
    Illegal PstI site found at 2642
    Illegal PstI site found at 3884
    Illegal NgoMIV site found at 4186
    Illegal AgeI site found at 3530
  • 1000
    COMPATIBLE WITH RFC[1000]