Difference between revisions of "Part:BBa K1722001"
 
(24 intermediate revisions by 2 users not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
−
 
+
<html>
−
 
+
<img style="width:10%" src="https://static.igem.org/mediawiki/2015/2/2c/SZU_China_igem_logo.png"/
−
==<partinfo>BBa_K1722001 short</partinfo>==
+
</html>
−
 
+
{| style="color:black" cellpadding="5" cellspacing="1" border="3" align="right"
 +
! colspan="2" style="background:#d7474e;"|super hTERT（shTERT）
 +
|-
 +
|'''Function'''
 +
|Super Promter
 +
|-
 +
|'''Use in'''
 +
|Cancer cells
 +
|-
 +
|'''RFC standard'''
 +
|[https://parts.igem.org/Help:Assembly_standard_10 RFC 10]
 +
|-
 +
|'''Backbone'''
 +
|[https://parts.igem.org/Help:Plasmid_Backbones pSB1C3]
 +
|-
 +
|'''Submitted by'''
 +
|[http://2015.igem.org/Team:SZU_China SZU_China 2015]
 +
|}
 +
=====<partinfo>BBa_K1722001 short</partinfo>=====
 
Telomerase reverse transcriptase(abbreviated to TERT, or hTERT in humans) is a catalytic subunit of the enzyme telomerase, which, together with the telomerase RNA component (TERC), comprises the most important unit of the telomerase complex.
 
Telomerase reverse transcriptase(abbreviated to TERT, or hTERT in humans) is a catalytic subunit of the enzyme telomerase, which, together with the telomerase RNA component (TERC), comprises the most important unit of the telomerase complex.
  
−
The telomerase is a ribonucleoprotein enzyme to which multiple functions have been attributed, the most important of these is the maintenance of the telomere which is related with cellular immortalization and cancer. 85% of human tumors have telomerase activity, that in normal cells goes undetected. These characteristics make the telomerase an attractive target for chemotherapy.
+
The telomerase is a ribonucleoprotein enzyme to which multiple functions have been attributed, the most important of these is the maintenance of the telomere which is related with cellular immortalization and cancer. 85% of human tumors have telomerase activity, that in normal cells goes undetected. These characteristics make the telomerase an attractive target for chemotherapy.<sup>[1]</sup>
 
The TERT promoter can specifically identify TERT proteins which are largely produced in human tumor cells, thus being expected to be tumor-specific in human body.  
 
The TERT promoter can specifically identify TERT proteins which are largely produced in human tumor cells, thus being expected to be tumor-specific in human body.  
−
TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). These mutations differentially enhanced the transcriptional activity of the TERT core promoter.TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients.
+
TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). <sup>[2]</sup> These mutations differentially enhanced the transcriptional activity of the TERT core promoter.TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients.
  
−
More importantly , we mutated the normal hTERT promoter into a super hTERT promoter(shTERT) with higher promote activity so as to make our system work more efficiently. Four base pairs of the TERT promoter sequence were mutated to form shTERT.
+
More importantly , <b>we mutated the wild-type hTERT promoter into a super hTERT promoter(shTERT) with higher activity so as to make our system work more efficiently.</b> Four base pairs of the TERT promoter sequence were mutated to form shTERT.<b>(Fig. 1)</b>
 
Eventually, the shTERT can be activated with the identification of specific RNA polymerase.
 
Eventually, the shTERT can be activated with the identification of specific RNA polymerase.
 +
 +
<html>
 +
<figure style="text-align: center"><img style="width:70%" src="https://static.igem.org/mediawiki/2015/a/a0/ShTERT_sequence.png"/><figcaption style="text-align:center"><b>Figure 1.</b> The sequence of shTERT. The four base pairs marked in red are mutated from wild-type hTERT promoter.</figcaption></figure>
 +
 +
</html>
 +
 +
Wu S et al. found that the shTERT promoter can enhance the expression of hTERT and maintain its tumor-specific feature.<sup>[1]</sup> The activity of shTERT promoter detected by luciferase assay was about three times as large as the wild-type hTERT promoter in bladder cancer cells, while it could not be measured in human fiber cells(HFC). According to Zhuang CL et al.<b>(Table 1)</b>, the drive efficiency of shTERT promoter was significantly higher than that of wild-type hTERT promoter in bladder cancer cells T24, 5637 and UM-UC-3. Other assays indicated that the synthetic device can significantly inhibit cell growth, decrease motility, and induce apoptosis in bladder cancer cells but not in HFC.<sup>[2]</sup>
 +
<html>
 +
<figure style="text-align: center"><img style="width:50%" src="https://static.igem.org/mediawiki/2015/a/a2/ShTERT_table.png"/></figure>
 +
 +
</html>
 
In our system, we use shTERT to initiate the expression of downstream DNA sequence. Together with bladder-specific promoter hUPII we can achieve the targeted recognization of bladder cancer cells. By using therapeutic genes(such as p21 and Bax) as effectors, targeted gene therapy for bladder cancer can be carried out. 
 
In our system, we use shTERT to initiate the expression of downstream DNA sequence. Together with bladder-specific promoter hUPII we can achieve the targeted recognization of bladder cancer cells. By using therapeutic genes(such as p21 and Bax) as effectors, targeted gene therapy for bladder cancer can be carried out. 
 
In our experiment, we constructed three plasmids system and two plasmids system before and after to verify the function using high-efficency shTERT.It can be activated inside cancer cells. Similar to our system, alike synthesizing gene circuits are also expected to be one of the promising approaches to the treatment of other cancer.
 
In our experiment, we constructed three plasmids system and two plasmids system before and after to verify the function using high-efficency shTERT.It can be activated inside cancer cells. Similar to our system, alike synthesizing gene circuits are also expected to be one of the promising approaches to the treatment of other cancer.
 +
 +
shTERT is 454bp in length. <b>Fig. 2</b> shows the DNA sequence of shTERT is successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of shTERT PCR product is rather high compared with DNA Marker, which indicates that the PCR product of shTERT is in a high concerntration.
 +
 +
<html>
 +
<figure style="text-align: center"><img style="width:30%" src="https://static.igem.org/mediawiki/2015/1/18/%E9%AB%98%E6%95%88tert_pcr2.png"/><figcaption style="text-align:center"><b>Figure 2</b> Electrophoretic analysis of PCR produution of hTERT promoter from psi-Check2. <figcaption style="text-align:center">(1:DL2000 DNA Marker 2:PCR production )</figcaption></figure>
 +
 +
</html>
  
 
__NOTOC__
 
__NOTOC__
Line 26: Line 62:
  
 
===References===
 
===References===
−
[1]Castillo Ureta H, Barrera Saldaña HA, Martínez Rodríguez HG (2003). "[Telomerase: an enzyme with multiple applications in cancer research]". Rev. Invest. Clin. 54 (4): 342–8. PMID 12415959
+
[1]Castillo Ureta H, Barrera Saldaña HA, Martínez Rodríguez HG. Telomerase: an enzyme with multiple applications in cancer research. Rev. Invest. Clin. 54 (4): 342–8. 
 +
 
 +
[2]Huang DS, Wang ZH, He XJ, et al. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation, European Journal of Cancer, 51: 969-976.
 +
 
 +
[3]Zhuang CL, Fu X, Liu L, et al. Synthetic miRNA sponges driven by mutant hTERT promoter selectively inhibit the progression of bladder cancer. Tumor Biol. 2015
  
−
[2]recurrent tert promoter mutations identified in a large-scale study of multiple tumour types are associated with increased tert expression and telomerase activation.PMID:25843513
+
[4]Wu S, Huang P, Li C, Huang Y, Li X, Wang Y, et al. Telomerase reverase transcriptase gene promotor mutations help discern the origin of urogenital tumors: a genomic and molecular study. Eur Urol. 2014;65(2):274–7.
  
 
<!-- Uncomment this to enable Functional Parameter display  
 
<!-- Uncomment this to enable Functional Parameter display  

Latest revision as of 14:13, 17 September 2015

super hTERT（shTERT）
Function Super Promter
Use in Cancer cells
RFC standard RFC 10
Backbone pSB1C3
Submitted by [http://2015.igem.org/Team:SZU_China SZU_China 2015]
shTERT is a cancer cell specific promoter with high efficiency.

Telomerase reverse transcriptase(abbreviated to TERT, or hTERT in humans) is a catalytic subunit of the enzyme telomerase, which, together with the telomerase RNA component (TERC), comprises the most important unit of the telomerase complex.

The telomerase is a ribonucleoprotein enzyme to which multiple functions have been attributed, the most important of these is the maintenance of the telomere which is related with cellular immortalization and cancer. 85% of human tumors have telomerase activity, that in normal cells goes undetected. These characteristics make the telomerase an attractive target for chemotherapy.[1] The TERT promoter can specifically identify TERT proteins which are largely produced in human tumor cells, thus being expected to be tumor-specific in human body. TERT promoter mutations were highly frequent in glioblastoma (83.9%), urothelial carcinoma (64.5%), oligodendroglioma (70.0%), medulloblastoma (33.3%) and hepatocellular carcinoma (31.4%). [2] These mutations differentially enhanced the transcriptional activity of the TERT core promoter.TERT promoter mutations are frequent in multiple tumour types and have similar distributions in Chinese cancer patients.

More importantly , we mutated the wild-type hTERT promoter into a super hTERT promoter(shTERT) with higher activity so as to make our system work more efficiently. Four base pairs of the TERT promoter sequence were mutated to form shTERT.(Fig. 1) Eventually, the shTERT can be activated with the identification of specific RNA polymerase.

Figure 1. The sequence of shTERT. The four base pairs marked in red are mutated from wild-type hTERT promoter.

Wu S et al. found that the shTERT promoter can enhance the expression of hTERT and maintain its tumor-specific feature.[1] The activity of shTERT promoter detected by luciferase assay was about three times as large as the wild-type hTERT promoter in bladder cancer cells, while it could not be measured in human fiber cells(HFC). According to Zhuang CL et al.(Table 1), the drive efficiency of shTERT promoter was significantly higher than that of wild-type hTERT promoter in bladder cancer cells T24, 5637 and UM-UC-3. Other assays indicated that the synthetic device can significantly inhibit cell growth, decrease motility, and induce apoptosis in bladder cancer cells but not in HFC.[2]

In our system, we use shTERT to initiate the expression of downstream DNA sequence. Together with bladder-specific promoter hUPII we can achieve the targeted recognization of bladder cancer cells. By using therapeutic genes(such as p21 and Bax) as effectors, targeted gene therapy for bladder cancer can be carried out.  In our experiment, we constructed three plasmids system and two plasmids system before and after to verify the function using high-efficency shTERT.It can be activated inside cancer cells. Similar to our system, alike synthesizing gene circuits are also expected to be one of the promising approaches to the treatment of other cancer.

shTERT is 454bp in length. Fig. 2 shows the DNA sequence of shTERT is successfully amplified by PCR from psi-Check2 vector. From this electrophoretogram, we can see the brightness of shTERT PCR product is rather high compared with DNA Marker, which indicates that the PCR product of shTERT is in a high concerntration.

Figure 2 Electrophoretic analysis of PCR produution of hTERT promoter from psi-Check2.
(1:DL2000 DNA Marker 2:PCR production )



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Design Notes

We designed the following primers and amplified hTERT promoter from the vector psi-Check2:Up: CCGGAATTCGGCACCTCCCTCGGGTTAG Down: TGCACTGCAGACTAGTCGCGTGGGTGGCCG. By incorporating these primers into hTERT promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.

Source

The telomerase reverse transcriptase promoter can be found in human cancer cells. In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, the verification of our system's function was also carried out in Shenzhen Second People's Hospital.

References

[1]Castillo Ureta H, Barrera Saldaña HA, Martínez Rodríguez HG. Telomerase: an enzyme with multiple applications in cancer research. Rev. Invest. Clin. 54 (4): 342–8. 

[2]Huang DS, Wang ZH, He XJ, et al. Recurrent TERT promoter mutations identified in a large-scale study of multiple tumour types are associated with increased TERT expression and telomerase activation, European Journal of Cancer, 51: 969-976.

[3]Zhuang CL, Fu X, Liu L, et al. Synthetic miRNA sponges driven by mutant hTERT promoter selectively inhibit the progression of bladder cancer. Tumor Biol. 2015

[4]Wu S, Huang P, Li C, Huang Y, Li X, Wang Y, et al. Telomerase reverase transcriptase gene promotor mutations help discern the origin of urogenital tumors: a genomic and molecular study. Eur Urol. 2014;65(2):274–7.