Difference between revisions of "Part:BBa K1668011"
Line 2: Line 2:
 
<partinfo>BBa_K1668011 short</partinfo>
 
<partinfo>BBa_K1668011 short</partinfo>
  
−
The <i>mCherry</i>is an improved part from BBa_J06702 in Part Registry, composed of RBS [https://parts.igem.org/Part: BBa_B0034], reporter <i>mCherry</i> [https://parts.igem.org/Part: BBa_J06702] and double terminator [https://parts.igem.org/Part: B0010] [https://parts.igem.org/Part: B0012]
 
−
<br>
 
−
<br>
 
−
We found out the sequence of<i> mCherry</i> in 2015 kit plate 3(well 15B) has a promoter with it, therefore doesn’t match the information in Part Registry. Then we sequenced <i>mCherry</i> in 2013, which proved to be correct but in a pSB1A2 backbone, and standardized the correct sequence by assemble the part with standard pSB1C3 backbone.
 
−
<br>
 
−
<br>
 
−
<!-- -->
 
−
<span class='h3bb'>Sequence and Features</span>
 
 
<partinfo>BBa_K1668011 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1668011 SequenceAndFeatures</partinfo>
  
−
 
−
<!-- Uncomment this to enable Functional Parameter display
 
−
===Functional Parameters===
 
−
<partinfo>BBa_K1668011 parameters</partinfo>
 
−
<!-- -->
 
−
 
−
<h2>'''Characterization'''</h2>
 
−
 
−
<h3> BACKGROUND </h3>
 
−
[[File:ZJU-CHINA_mCherry_figure1.png|200px|thumb|left|Figure 1 Iformation of <i> mCherry</i>(BBa_J06702) in Part Registry.]]
 
−
[[File:ZJU-CHINA_2015_mCherry.png|200px|thumb|left|Figure 2 Sequencing results of 2015 <i>mCherry</i> in 2015 kit plate 3, well 15B.]]
 
−
[[File:ZJU-CHINA_mCherry_figure3.png|200px|thumb|right|Figure 3 Double enzyme digestion of the 2012<i>mCherry <i>(BBa_J06702) in 2012 kit plate 2, well 8E.]]
 
 
<br>
 
<br>
−
We used <i>mCherry</i> (BBa_J06702) as a reporter, which is one registry star and therefore comparably more reliable. According to the message in the Registry, there is no promoter in the part therefore the reporter should not be expressed(figure 1).
 
 
<br>
 
<br>
 +
===Source===
 +
 +
The <i>mCherry</i> gene was amplified by PCR with the template genomic DNA extracted from strain <i>Photorhabdus luminescens TT01</i>. We got the strain from Shandong University.
 
<br>
 
<br>
−
[[File:ZJU-CHINA_2015_mCherry.png|200px|thumb|left|Figure 4 Sequencing results of 2012 <i>mCherry<i> in 2012 kit plate 2, well 8E.]]
 
−
But when we transformed the <i>mCherry</i> gene into <i>E.coli DH5α</i>, the <i>E.coli</i> turned out to become red. With the colorless control, we concluded that the <i>mCherry</i> was expressed and sequnced the parts. According to the results of the sequncing, the part has a promoter with it (figure 2).
 
 
<br>
 
<br>
 +
===Design Notes===
 +
 +
<h4>PCR</h4>
 +
The <i> mCherry </i> gene was amplified by PCR with the template genomic DNA extracted from strain <i>Photorhabdus luminescens TT01</i>. We use primer mCherry -left F and mCherry R to amplify the left side of gene, which are shown below.
 
<br>
 
<br>
−
Then we got the same part from kit plate in 2013 and 2012. At last, we used <i>mCherry</i> of 2012 in backbone pSB1A2, which is a 2k backbone. But after we have cut the backbone with XbaI and SpeI, we found that the backbone was as big as 4k (figure 3). So we had to sequnce the <i>mCherry</i> of 2012, which turned out to be correct (figure 4). And the backbone had an anti-ampicillin gene with it.  
+
<h4>Seamless assembly</h4>
 +
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way prefix sequence, <i> mCherry </i> and suffix sequence can be ligated seamlessly.  
 
<br>
 
<br>
 
<br>
 
<br>
−
Therefore we concluded that the 2012 <i>mCherry</i> is a correct part with the wrong backbone. Now we had assembled the correct <i>mCherry</i> with pSB1C3 and the<i> mCherry</i> functions well in our other devices (device tcdA1, device plu1537 and device plu0840)
+
mCherry F(F, 5’-3’): AGAAAGAGGAGAAATACTAGATGGTGAG <br><br>
 +
mCherry R(R, 5’-3’): CCGGACTGCAGCGGCCGCTACTAGTATAAACGCAGAAAGGCC <br><br>
 
<br>
 
<br>
 
<br>
 
<br>
 +
<h4>Transformation and confirmation</h4>
 +
After seamless assembly, standard plasmid pSB1C3 containing <i> mCherry </i> gene was transformed into <i> E.coli DH5α</i>. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
 
<br>
 
<br>
−
<h3> RESULTS </h3>
 
−
<h4> PLASMID CONSTRUCTION </h4>
 
−
[[File:ZJU-CHINA_mCherry_figure5.png|200px|thumb|left|Figure 5 Double enzyme digestion of the improved<i>mCherry </i>.]]
 
 
<br>
 
<br>
−
5-μl samples of the double enzyme digestion products for improved <i>mCherry</i> BBa_K1668011 were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters.  
+
<h4>Plasmid map</h4>
 +
[[File:ZJU-CHINA_TPmCherry.png|300px|thumb|left|Fig.3 the plasmid map of BBa_K1668011]]
 
<br>
 
<br>
−
Sizes of the XbaI and PstI–cleaved assemblies were determined by AGE analysis.
 
 
<br>
 
<br>
−
The DNA size standards were 1kb DNA Ladder (Dye Plus)(M2; TaKaRa, Cat#3426A).
 
−
<br>
 
−
Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager.
 
 
<br>
 
<br>
−
Digested plasmid backbone and <i>mCherry</i> fragment are indicated.
 
 
<br>
 
<br>
 
<br>
 
<br>
−
It can be clearly seen that the 900bp <i>mCherry</i> is in the right position in agarose gel.
 
 
<br>
 
<br>
 
<br>
 
<br>
Line 62: Line 42:
 
<br>
 
<br>
 
<br>
 
<br>
−
<h4> DNA SEQUENCING </h4>
 
−
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 1k part shows 100% agreement with the desired sequence.
 
 
<br>
 
<br>
 
<br>
 
<br>
−
<h4> EXPRESSION </h4>
 
−
[[File:ZJU-CHINA_expression.png|200px|thumb|left|Figure 6 Tandem expression of toxin protein and <i> mCherry </i>shown in pipet tube. ]]
 
 
<br>
 
<br>
 
<br>
 
<br>
−
1ml bacterium solution was added in each pipet tube and centrifuged in a speed of 12000 rpm of for 2min.
 
 
<br>
 
<br>
 
<br>
 
<br>
−
We serial express our three toxins (TcdA1, Plu1537 and Plu0840) with MCherry, shown in figure 6.
+
 
−
<br>
+
 
−
The redness of all three devices indicates that <i>mCherry</i> functions well.
+
 
 +
 
 +
===References===

Revision as of 20:14, 16 September 2015

mCherry


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]



Source

The mCherry gene was amplified by PCR with the template genomic DNA extracted from strain Photorhabdus luminescens TT01. We got the strain from Shandong University.

Design Notes

PCR

The mCherry gene was amplified by PCR with the template genomic DNA extracted from strain Photorhabdus luminescens TT01. We use primer mCherry -left F and mCherry R to amplify the left side of gene, which are shown below.

Seamless assembly

We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way prefix sequence, mCherry and suffix sequence can be ligated seamlessly.

mCherry F(F, 5’-3’): AGAAAGAGGAGAAATACTAGATGGTGAG

mCherry R(R, 5’-3’): CCGGACTGCAGCGGCCGCTACTAGTATAAACGCAGAAAGGCC



Transformation and confirmation

After seamless assembly, standard plasmid pSB1C3 containing mCherry gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.

Plasmid map

Fig.3 the plasmid map of BBa_K1668011





















References