Difference between revisions of "Part:BBa K1668002:Design"
(→‎Design Notes)
 
(8 intermediate revisions by the same user not shown)
Line 5: Line 5:
 
The part frr is the coding sequence of ribosome recycling factor (RRF) in Streptomyces avermitilis. It was found to promote cell growth and stimulate the production of avermectins, one kind of pesticide.  
 
The part frr is the coding sequence of ribosome recycling factor (RRF) in Streptomyces avermitilis. It was found to promote cell growth and stimulate the production of avermectins, one kind of pesticide.  
 
<br>
 
<br>
−
This gene sequence could not function in E.coli. If you would like to express frr in Streptomyces avermitilis, remember to add ermEp [(BBa_K1668004)] as its promoter.
+
<br>
−
 
+
This gene sequence could not function in E.coli. If you would like to express frr in Streptomyces avermitilis, remember to add ermEp [1] as its promoter.
−
<!-- -->
+
<br>
−
 
+
<br>
−
<span class='h3bb'>Sequence and Features</span>
+
 
<partinfo>BBa_K1668002 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1668002 SequenceAndFeatures</partinfo>
 +
<br>
 +
<br>
 +
===Source===
 +
The frr gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.
 +
<br>
 +
<br>
 +
===Design Notes===
 +
<h4>PCR</h4>
 +
The frr gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.
 +
By PCR with primers frr1 and frr2 shown below, we added the standard prefix and suffix at both ends of the frr sequence.
  
 +
<h4>Seamless assembly</h4>
 +
We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
 +
<br>
 +
frr1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGCGCGGGTACGTC
 +
<br>
 +
frr2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTACATCAAGGTCGCC
 +
<h4>Transformation and confirmation</h4>
 +
After seamless assembly, standard plasmid pSB1C3 containing frr gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers.
 +
The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.
  
−
<!-- Uncomment this to enable Functional Parameter display
+
<h4>Plasmid map</h4>
−
===Functional Parameters===
+
[[File:ZJU-CHINA_frr_map.png|300px|thumb|left|Fig.3 the plasmid map of BBa_K1668002]]
−
<partinfo>BBa_K1668002 parameters</partinfo>
+
−
<!-- -->
+
−
 
+
−
 
+
−
<h2>'''Characterization'''</h2>
+
−
<h3> BACKGROUND </h3>[[File:MetK-struc.jpeg|800px|thumb|right|Fig.1 the 3D structure of S-adenosylmethionine synthetase (Uniprot #: Q3HW35)]]
+
−
<h4>Overview</h4>
+
−
metK is the gene encoding S-adenosylmethionine synthetase, which has been found in almost every organism. Its output catalyzes the formation of S-adenosylmethionine from methionine and ATP.
+
 
<br>
 
<br>
−
<h4>Function</h4>
 
−
In Streptomyces avermitilis, metK was found to stimulate the production of avermectins. When wild-type S. avermitilis strain ATCC31267 was transformed with pYJ02 and pYJ03, two metK expression plasmids, avermectin production was increased about 2.0-fold and 5.5-fold compared with that in the control strains, respectively.
 
 
<br>
 
<br>
−
<h4>Principle</h4>
 
−
As for the principle of improving the productivity, instead of changing cell growth or copy effect, metK stimulates the avermectin production by increasing the intracellular concentration of S-adenosylmethionine (SAM), an important intermediate product in avermectin production. However, there may be a maximum concentration of SAM for the production of avermectin in S. avermitilis, which means that SAM has no effect when its concentration achieve maximum.
 
 
<br>
 
<br>
−
 
−
<h4>Limitation</h4>
 
−
The results of experiments in research paper showed that different metK expression levels have different influence on avermectin production in various S. avermitilis strains. The gene expression levels of metK in two engineered strain, GB-165 and 76-05, were much higher than those in wild-type strain, whereas the avermectin productivity in these two strains have not been significantly improved. It is probably because the high expression level of metK in engineered strains limited the improvement of avermectin productivity by overexpression of metK.
 
 
<br>
 
<br>
−
<h4>Protein</h4>
 
−
The 3D structure of S-adenosylmethionine synthetase is as above (Fig.1). This enzyme catalyzes the formation of S-adenosylmethionine from methionine and ATP and is involved in step1 of the subpathway that synthesizes S-adenosyl-L-methionine from L-methionine.
 
 
<br>
 
<br>
 
<br>
 
<br>
−
<h3>RESULTS</h3>
 
−
<h4>Gel electrophoretic analysis</h4>
 
−
[[File:屏幕快照 2015-09-14 下午10.15.57.png|600px|thumb|left|Fig.2 Gel electrophoretic analyses of PCR products (A) and selected examples of cloned products of seamless assembly reaction (B)]]
 
−
In Fig.2,  (A) 5-μl samples of the PCR products for metK, (B) 5-μl samples of the bacteria solution PCR products were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. The DNA size standards was the DL1,000 DNA Marker (M1; Takara, Cat#3428A) and DL2,000 DNA Marker (M2; TaKaRa, Cat#3427A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. PCR products, positive clones and negative clones are indicated.
 
 
<br>
 
<br>
 
<br>
 
<br>
Line 49: Line 46:
 
<br>
 
<br>
 
<br>
 
<br>
−
<h4>DNA sequencing</h4>
 
−
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 816bp part shows 100% agreement with the desired sequence.
 
 
<br>
 
<br>
−
<h3>REFERENCE</h3>
 
−
Zhao, X., et al. (2013). "Overexpression of metK shows different effects on avermectin production in various Streptomyces avermitilis strains." World J Microbiol Biotechnol 29(10): 1869-1875.
 
 
<br>
 
<br>
−
http://www.uniprot.org/uniprot/Q827Q0
 
 
<br>
 
<br>
 
<br>
 
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
 +
===References===
 +
Li, L., et al. (2010). "Overexpression of ribosome recycling factor causes increased production of avermectin in Streptomyces avermitilis strains." J Ind Microbiol Biotechnol 37(7): 673-679.
 +
<br>
 +
http://www.uniprot.org/uniprot/Q82JY0

Latest revision as of 14:28, 16 September 2015

frr (from Streptomyces avermitilis, increasing avermectin production)

The part frr is the coding sequence of ribosome recycling factor (RRF) in Streptomyces avermitilis. It was found to promote cell growth and stimulate the production of avermectins, one kind of pesticide.

This gene sequence could not function in E.coli. If you would like to express frr in Streptomyces avermitilis, remember to add ermEp [1] as its promoter.


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 165
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 337



Source

The frr gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.

Design Notes

PCR

The frr gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain. By PCR with primers frr1 and frr2 shown below, we added the standard prefix and suffix at both ends of the frr sequence.

Seamless assembly

We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
frr1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGCGCGGGTACGTC
frr2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTACATCAAGGTCGCC

Transformation and confirmation

After seamless assembly, standard plasmid pSB1C3 containing frr gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.

Plasmid map

Fig.3 the plasmid map of BBa_K1668002






















References

Li, L., et al. (2010). "Overexpression of ribosome recycling factor causes increased production of avermectin in Streptomyces avermitilis strains." J Ind Microbiol Biotechnol 37(7): 673-679.
http://www.uniprot.org/uniprot/Q82JY0