Difference between revisions of "Part:BBa K1833999"

Revision as of 17:18, 15 September 2015

T7 promoter as annealed oligos

This is a part used as a building block for T7 driven expression. However, this part uses a special method with the following synthesized nucleotides:

pT7sense: aattcgcggccgcttctagataatacgactcactatagggagaa

pT7antisense: ctagttctccctatagtgagtcgtattatctagaagcggccgcg

The following method can be used to insert a T7 promoter before a desired Biobrick part (which should contain an RBS at minimum and preferably a cds and terminator):

1. Cut the desired plasmid with EcoRI and XbaI. Purify the plasmid with a method of your choice (both gel purification and PCR purification kits from Qiagen serve to remove the short undesired oligonucleotide from the digestion).

2. Be sure that your oligos have 5' phosphorylation (treat unphosphorylated oligos with T4 Polynucleotide Kinase). Then, anneal the two oligos by slowly cooling from 98C to room temperature.

3. Finally, ligate the cut plasmid with the annealed oligos by using a 1:10 molar ratio of plasmid to insert.

4. Transform the ligation reaction into E. coli, and plate.

5. Pick colonies, and verify the success of the cloning with sequencing or PCR. (Doing a diagnostic digest is not recommended as the size of the original plasmid and the desired plasmid are very similar.)

6. Add a composite part to the iGEM registry by using this part with the original protein coding part, checking the box to create without a scar, as this part contains a modified scar.

Sequence and Features