Difference between revisions of "Part:BBa K1723004:Design"
E.Cuillery (Talk | contribs) (→Design Notes) |
E.Cuillery (Talk | contribs) (→Design Notes) |
||
Line 9: | Line 9: | ||
This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [3] and the specific sequence for the gRNA Z35 was designed from the sequence of the plasmid pWJ89 D.Bikard [1] sent us. | This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [3] and the specific sequence for the gRNA Z35 was designed from the sequence of the plasmid pWJ89 D.Bikard [1] sent us. | ||
− | this part contains deletions comparing to the original design, the 92nd base of the promoter and the 27th base of the terminator are missing. The original sequence for pBAD promoter is: | + | this part contains deletions comparing to the original design, the 92nd base of the promoter and the 27th base of the terminator are missing. The original sequence for pBAD promoter is: GGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCC |
+ | ATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATA, and the original sequence of the terminator is: ATTGCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT. All of our tests were performed with the deletions and it didn't affect the sgRNA function. | ||
===Source=== | ===Source=== |
Revision as of 16:30, 15 September 2015
sgRNA Z35 expressing cassette
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 178
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 125
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
This part was design on the model for sgRNAs on the paper from Alec AK Nielsen & Christopher A Voigt [3] and the specific sequence for the gRNA Z35 was designed from the sequence of the plasmid pWJ89 D.Bikard [1] sent us.
this part contains deletions comparing to the original design, the 92nd base of the promoter and the 27th base of the terminator are missing. The original sequence for pBAD promoter is: GGGACCAAAGCCATGACAAAAACGCGTAACAAAAGTGTCTATAATCACGGCAGAAAAGTCCACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCATTTTTATCC ATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATA, and the original sequence of the terminator is: ATTGCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT. All of our tests were performed with the deletions and it didn't affect the sgRNA function.
Source
this part was fully synthesized.