Difference between revisions of "Part:BBa K1668002:Design"

Revision as of 10:26, 15 September 2015

metK (from Streptomyces avermitilis, increasing avermectin production)

Source

The frr gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain.

Design Notes

PCR

The frr gene was amplified by PCR with genomic DNA extracted from S. avermitilis ATCC31267 strain as template. We commercially purchased this strain. By PCR with primers frr1 and frr2 shown below, we added the standard prefix and suffix at both ends of the frr sequence.

Seamless assembly

We used seamless assembly as our assembly method so restriction digestion and T4 ligation can be avoided. Detailed protocol and instruction for primer design can be seen in our Protocol. By this way, prefix sequence, metK, and suffix sequence can be ligated seamlessly.
frr1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGCGCGGGTACGTC
frr2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTACATCAAGGTCGCC

Transformation and confirmation

After seamless assembly, standard plasmid pSB1C3 containing frr gene was transformed into E.coli DH5α. When single colony appeared on the LB plate, we picked out 10 colonies, respectively, as our template for bacteria solution PCR. In order to avoid the appearance of false positive clones, we used VF2/VR as the universal primers. The positive clone and its corresponding raw bacteria solution were stored and samples were sent to do DNA sequencing.

Plasmid map

Fig.3 the plasmid map of BBa_K1668002

References

Li, L., et al. (2010). "Overexpression of ribosome recycling factor causes increased production of avermectin in Streptomyces avermitilis strains." J Ind Microbiol Biotechnol 37(7): 673-679.
http://www.uniprot.org/uniprot/Q82JY0