Difference between revisions of "Part:BBa K1668002:Design"

(References)
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
<partinfo>BBa_K1668002 short</partinfo>
+
<partinfo>BBa_K1668001 short</partinfo>
 +
<br>
 +
<br>
 +
The part frr is the coding sequence of ribosome recycling factor (RRF) in Streptomyces avermitilis. It was found to promote cell growth and stimulate the production of avermectins, one kind of pesticide.
 +
<br>
 +
This gene sequence could not function in E.coli. If you would like to express frr in Streptomyces avermitilis, remember to add ermEp [(BBa_K1668004)] as its promoter.
  
 +
<!-- -->
 +
 +
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K1668002 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1668002 SequenceAndFeatures</partinfo>
  
  
===Design Notes===
+
<!-- Uncomment this to enable Functional Parameter display
By PCR with primers frr1 and frr2 shown below, we added the standard prefix and suffix at both ends of the frr sequence. We used seamless assembly as our assembly method. Therefore, there are no scar between prefix sequence, frr, and suffix sequence.
+
===Functional Parameters===
 +
<partinfo>BBa_K1668002 parameters</partinfo>
 +
<!-- -->
 +
 
 +
 
 +
<h2>'''Characterization'''</h2>
 +
<h3> BACKGROUND </h3>[[File:MetK-struc.jpeg|800px|thumb|right|Fig.1 the 3D structure of S-adenosylmethionine synthetase (Uniprot #: Q3HW35)]]
 +
<h4>Overview</h4>
 +
metK is the gene encoding S-adenosylmethionine synthetase, which has been found in almost every organism. Its output catalyzes the formation of S-adenosylmethionine from methionine and ATP.  
 
<br>
 
<br>
frr1 (F, 5’-3’): GAATTCGCGGCCGCTTCTAGATGCGCGGGTACGTC
+
<h4>Function</h4>
 +
In Streptomyces avermitilis, metK was found to stimulate the production of avermectins. When wild-type S. avermitilis strain ATCC31267 was transformed with pYJ02 and pYJ03, two metK expression plasmids, avermectin production was increased about 2.0-fold and 5.5-fold compared with that in the control strains, respectively.
 +
<br>
 +
<h4>Principle</h4>
 +
As for the principle of improving the productivity, instead of changing cell growth or copy effect, metK stimulates the avermectin production by increasing the intracellular concentration of S-adenosylmethionine (SAM), an important intermediate product in avermectin production. However, there may be a maximum concentration of SAM for the production of avermectin in S. avermitilis, which means that SAM has no effect when its concentration achieve maximum.
 
<br>
 
<br>
frr2 (R, 5’-3’): TGCAGCGGCCGCTACTAGTATTATTACATCAAGGTCGCC
 
  
===Source===
+
<h4>Limitation</h4>
 
+
The results of experiments in research paper showed that different metK expression levels have different influence on avermectin production in various S. avermitilis strains. The gene expression levels of metK in two engineered strain, GB-165 and 76-05, were much higher than those in wild-type strain, whereas the avermectin productivity in these two strains have not been significantly improved. It is probably because the high expression level of metK in engineered strains limited the improvement of avermectin productivity by overexpression of metK.
The frr gene was amplified by PCR with genomic DNA of S. avermitilis ATCC31267 strain as template.
+
<br>
 
+
<h4>Protein</h4>
===References===
+
The 3D structure of S-adenosylmethionine synthetase is as above (Fig.1). This enzyme catalyzes the formation of S-adenosylmethionine from methionine and ATP and is involved in step1 of the subpathway that synthesizes S-adenosyl-L-methionine from L-methionine.
Li, L., et al. (2010). "Overexpression of ribosome recycling factor causes increased production of avermectin in Streptomyces avermitilis strains." J Ind Microbiol Biotechnol 37(7): 673-679.<br>
+
<br>
http://www.uniprot.org/uniprot/Q82JY0
+
<br>
 +
<h3>RESULTS</h3>
 +
<h4>Gel electrophoretic analysis</h4>
 +
[[File:屏幕快照 2015-09-14 下午10.15.57.png|600px|thumb|left|Fig.2 Gel electrophoretic analyses of PCR products (A) and selected examples of cloned products of seamless assembly reaction (B)]]
 +
In Fig.2, (A) 5-μl samples of the PCR products for metK, (B) 5-μl samples of the bacteria solution PCR products were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. The DNA size standards was the DL1,000 DNA Marker (M1; Takara, Cat#3428A) and DL2,000 DNA Marker (M2; TaKaRa, Cat#3427A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. PCR products, positive clones and negative clones are indicated.
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<br>
 +
<h4>DNA sequencing</h4>
 +
We have sequenced the parts with standard primers VF2 and VR. The sequence of the 816bp part shows 100% agreement with the desired sequence.
 +
<br>
 +
<h3>REFERENCE</h3>
 +
Zhao, X., et al. (2013). "Overexpression of metK shows different effects on avermectin production in various Streptomyces avermitilis strains." World J Microbiol Biotechnol 29(10): 1869-1875.
 +
<br>
 +
http://www.uniprot.org/uniprot/Q827Q0
 +
<br>
 +
<br>

Revision as of 10:14, 15 September 2015

metK (from Streptomyces avermitilis, increasing avermectin production)

The part frr is the coding sequence of ribosome recycling factor (RRF) in Streptomyces avermitilis. It was found to promote cell growth and stimulate the production of avermectins, one kind of pesticide.
This gene sequence could not function in E.coli. If you would like to express frr in Streptomyces avermitilis, remember to add ermEp [(BBa_K1668004)] as its promoter.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 165
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 337



Characterization

BACKGROUND

Fig.1 the 3D structure of S-adenosylmethionine synthetase (Uniprot #: Q3HW35)

Overview

metK is the gene encoding S-adenosylmethionine synthetase, which has been found in almost every organism. Its output catalyzes the formation of S-adenosylmethionine from methionine and ATP.

Function

In Streptomyces avermitilis, metK was found to stimulate the production of avermectins. When wild-type S. avermitilis strain ATCC31267 was transformed with pYJ02 and pYJ03, two metK expression plasmids, avermectin production was increased about 2.0-fold and 5.5-fold compared with that in the control strains, respectively.

Principle

As for the principle of improving the productivity, instead of changing cell growth or copy effect, metK stimulates the avermectin production by increasing the intracellular concentration of S-adenosylmethionine (SAM), an important intermediate product in avermectin production. However, there may be a maximum concentration of SAM for the production of avermectin in S. avermitilis, which means that SAM has no effect when its concentration achieve maximum.

Limitation

The results of experiments in research paper showed that different metK expression levels have different influence on avermectin production in various S. avermitilis strains. The gene expression levels of metK in two engineered strain, GB-165 and 76-05, were much higher than those in wild-type strain, whereas the avermectin productivity in these two strains have not been significantly improved. It is probably because the high expression level of metK in engineered strains limited the improvement of avermectin productivity by overexpression of metK.

Protein

The 3D structure of S-adenosylmethionine synthetase is as above (Fig.1). This enzyme catalyzes the formation of S-adenosylmethionine from methionine and ATP and is involved in step1 of the subpathway that synthesizes S-adenosyl-L-methionine from L-methionine.

RESULTS

Gel electrophoretic analysis

Fig.2 Gel electrophoretic analyses of PCR products (A) and selected examples of cloned products of seamless assembly reaction (B)

In Fig.2, (A) 5-μl samples of the PCR products for metK, (B) 5-μl samples of the bacteria solution PCR products were loaded onto a 1% BioRad Ready Agarose Mini Gel, then subjected to AGE. See (protocol) for AGE parameters. The DNA size standards was the DL1,000 DNA Marker (M1; Takara, Cat#3428A) and DL2,000 DNA Marker (M2; TaKaRa, Cat#3427A). Bands were visualized with a Shanghai Peiqing JS-380A Fluorescence Imager. PCR products, positive clones and negative clones are indicated.






DNA sequencing

We have sequenced the parts with standard primers VF2 and VR. The sequence of the 816bp part shows 100% agreement with the desired sequence.

REFERENCE

Zhao, X., et al. (2013). "Overexpression of metK shows different effects on avermectin production in various Streptomyces avermitilis strains." World J Microbiol Biotechnol 29(10): 1869-1875.
http://www.uniprot.org/uniprot/Q827Q0