Difference between revisions of "Part:BBa K1773003:Design"

(→‎Design Notes)
(→‎Design Notes)
 
(4 intermediate revisions by 2 users not shown)
Line 6: Line 6:
  
 
===Design Notes===
 
===Design Notes===
−
The Wild type Cas3 gene has unwanted EcoRI, XbaI and PstI restriction sites inside the gene.
+
Gene mutagenesis was performed using Invitrogen GeneArt® Site-Directed Mutagenesis PLUS System kit.
 +
These mutagenic primers were used:
  
 +
EcoRI mutagenesis: <br />
 +
F: cgttttcaatggcagaatccggcatttgatttggca<br />
 +
R: tgccaaatcaaatgccggattctgccattgaaaacg<br />
  
−
[[File:Cas3 genolapis1.png|300px|thumb|('''Figure1. Wild type Cas3 plasmid map.''' There are two restriction sites for each restriction enzyme all in close proximity. Restriction sites inside the gene coding reagion were mutated.)|center]]
+
XbaI Mutagenesis:<br />
 +
F: cgatcatcattattcttctctggatgctgatgttaatttggg<br />
 +
R: cccaaattaacatcagcatccagagaagaataatgatgatcg<br />
  
 +
PstI Mutagenesis:<br />
 +
F: gaagactgaactgcctgcggttaaacaacataaac<br />
 +
Re: gtttatgttgtttaaccgcaggcagttcagtcttc<br />
  
−
These restriction sites were mutated to make this gene biobrick compatible. First multiple mutagenesis attempt was not fully successful, because restriction analysis of mutated plasmids showed, that only two out of three restriction sites were mutated.
 
  
 +
Primers for adding Biobrick prefix and suffix:
  
−
[[File:Cas3 1.png|300px|thumb|('''Figure 2. First restriction analysis.''' Restriction with EcoRI (E), XbaI (X) and PstI (P) of Wild type (WT) Cas3 gene compared to mutated Cas3 genes. The first mutant plasmid has two successful mutations, whereas the second mutant plasmid only has one successfully mutated restriction site.)|center]]
+
Fw: ttaaggaattcgcggccgcttctagatgaatatcttacttgttagccaatgccaaaaaaa
  
−
 
+
Rev: cggctgcagcggccgctactagtagagatcttcctgccaaaaacccagcgttt
−
Later we mutagenised the Mutant#1 plasmid, for the third PstI restriction using the same procedure as before. After plasmid restriction analysis (Figure 2) we had many successfully mutated plasmid (all except mutated plasmid #1), which later were sequenced and confirmed.
+
−
 
+
−
 
+
−
[[File:Cas3 2.png|300px|thumb|('''Figure 3. Restriction analysis of Cas3 mutagenesis second run.''' K - undigested Wild type Cas3 plasmid. E - digested with EcoRI; X - digested with XbaI; P - digested with PstI.)|center]]
+
−
 
+
−
===Source===
+
−
 
+
−
<i>A.actinomycetemcomitans</i> D7-S
+
−
 
+
−
===References===
+

Latest revision as of 15:11, 10 September 2015

I-F type CRISPR-Cas Cas3 gene


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 2623
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 1344
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 2307
    Illegal AgeI site found at 2680
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

Gene mutagenesis was performed using Invitrogen GeneArt® Site-Directed Mutagenesis PLUS System kit.

These mutagenic primers were used:

EcoRI mutagenesis:
F: cgttttcaatggcagaatccggcatttgatttggca
R: tgccaaatcaaatgccggattctgccattgaaaacg

XbaI Mutagenesis:
F: cgatcatcattattcttctctggatgctgatgttaatttggg
R: cccaaattaacatcagcatccagagaagaataatgatgatcg

PstI Mutagenesis:
F: gaagactgaactgcctgcggttaaacaacataaac
Re: gtttatgttgtttaaccgcaggcagttcagtcttc


Primers for adding Biobrick prefix and suffix:

Fw: ttaaggaattcgcggccgcttctagatgaatatcttacttgttagccaatgccaaaaaaa

Rev: cggctgcagcggccgctactagtagagatcttcctgccaaaaacccagcgttt