Difference between revisions of "Part:BBa K1773003"
Line 4: | Line 4: | ||
I-F type CRISPR-Cas system Cas3 gene. This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible. This protein is one of the core components of I-type CRISPR-Cas DNA interference. DNA degradation starts when another ribonucleoprotein complex named Cascade (BBa_K1773005) finds the target DNA and begins to bond to the complementary strand of the DNA with its crRNA molecule. Then Cas3 is recruited, which targets the non-complementary ssDNA and uses its helicase-nuclease activity to degrade the DNA in a 3'-5' direction. | I-F type CRISPR-Cas system Cas3 gene. This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible. This protein is one of the core components of I-type CRISPR-Cas DNA interference. DNA degradation starts when another ribonucleoprotein complex named Cascade (BBa_K1773005) finds the target DNA and begins to bond to the complementary strand of the DNA with its crRNA molecule. Then Cas3 is recruited, which targets the non-complementary ssDNA and uses its helicase-nuclease activity to degrade the DNA in a 3'-5' direction. | ||
− | <!-- | + | <!-- This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible |
+ | |||
===Usage and Biology=== | ===Usage and Biology=== | ||
+ | <!-- This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible | ||
This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible | This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible | ||
+ | |||
<!-- --> | <!-- --> | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> |
Revision as of 15:32, 9 September 2015
I-F type CRISPR-Cas Cas3 gene
I-F type CRISPR-Cas system Cas3 gene. This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible. This protein is one of the core components of I-type CRISPR-Cas DNA interference. DNA degradation starts when another ribonucleoprotein complex named Cascade (BBa_K1773005) finds the target DNA and begins to bond to the complementary strand of the DNA with its crRNA molecule. Then Cas3 is recruited, which targets the non-complementary ssDNA and uses its helicase-nuclease activity to degrade the DNA in a 3'-5' direction.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2623
- 21INCOMPATIBLE WITH RFC[21]Unknown
- 23INCOMPATIBLE WITH RFC[23]Unknown
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 2307
Illegal AgeI site found at 2680 - 1000COMPATIBLE WITH RFC[1000]
The Wild type Cas3 gene has been cloned in Institute of Biotechnology and has unwanted EcoRI, XbaI and PstI restriction sites inside the gene.
These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.
These mutagenic primers were used:
EcoRI mutagenesis : Fw: cgttttcaatggcagaatccggcatttgatttggca Rev: tgccaaatcaaatgccggattctgccattgaaaacg
XbaI Mutagenesis: Fw: cgatcatcattattcttctctggatgctgatgttaatttggg Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg
PstI Mutagenesis: Fw: gaagactgaactgcctgcggttaaacaacataaac Rev: gtttatgttgtttaaccgcaggcagttcagtcttc
First multiple mutagenesis attempt was not fully successful, because restriction analysis (Figure 2.) of mutated plasmids showed, that only two out of three restriction sites were mutated.
Later we mutagenised the Mutant#1 plasmid, for the third PstI restriction using the same procedure as before. After plasmid restriction analysis (Figure 3) we had many successfully mutated plasmid (all except mutated plasmid #1), which later were sequenced and confirmed.