Difference between revisions of "Part:BBa K1773003"
Line 10: Line 10:
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K1773003 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K1773003 SequenceAndFeatures</partinfo>
 +
 +
 +
 +
The Wild type Cas3 gene has been cloned in Institute of Biotechnology and has unwanted EcoRI, XbaI and PstI restriction sites inside the gene.
 +
 +
 +
[[File:Cas3 genolapis1.png|300px|thumb|('''Figure1. Wild type Cas3 plasmid map.''' There are two restriction sites for each restriction enzyme all in close proximity. )|center]]
 +
 +
 +
These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.
 +
These mutagenic primers were used:
 +
 +
EcoRI mutagenesis :
 +
Fw: cgttttcaatggcagaatccggcatttgatttggca
 +
Rev: tgccaaatcaaatgccggattctgccattgaaaacg
 +
 +
XbaI Mutagenesis:
 +
Fw: cgatcatcattattcttctctggatgctgatgttaatttggg
 +
Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg
 +
 +
PstI Mutagenesis:
 +
Fw: gaagactgaactgcctgcggttaaacaacataaac
 +
Rev: gtttatgttgtttaaccgcaggcagttcagtcttc
 +
 +
First multiple mutagenesis attempt was not fully successful, because restriction analysis (Figure 2.) of mutated plasmids showed, that only two out of three restriction sites were mutated.
 +
 +
 +
[[File:Cas3 1.png|300px|thumb|('''Figure 2. First restriction analysis.''' Restriction with EcoRI (E), XbaI (X) and PstI (P) of Wild type (WT) Cas3 gene compared to mutated Cas3 genes. The first mutant plasmid has two successful mutations, whereas the second mutant plasmid only has one successfully mutated restriction site.)|center]]
 +
 +
 +
Later we mutagenised the Mutant#1 plasmid, for the third PstI restriction using the same procedure as before. After plasmid restriction analysis (Figure 3) we had many successfully mutated plasmid (all except mutated plasmid #1), which later were sequenced and confirmed.
 +
 +
 +
[[File:Cas3 2.png|300px|thumb|('''Figure 3. Restriction analysis of Cas3 mutagenesis second run.''' K - undigested Wild type Cas3 plasmid. E - digested with EcoRI; X - digested with XbaI; P - digested with PstI.)|center]]
  
  

Revision as of 15:29, 9 September 2015

I-F type CRISPR-Cas Cas3 gene

I-F type CRISPR-Cas system Cas3 gene. This Cas3 gene has mutated EcoRI, XbaI, PstI sites for it to be biobrick compatible. This protein is one of the core components of I-type CRISPR-Cas DNA interference. DNA degradation starts when another ribonucleoprotein complex named Cascade (BBa_K1773005) finds the target DNA and begins to bond to the complementary strand of the DNA with its crRNA molecule. Then Cas3 is recruited, which targets the non-complementary ssDNA and uses its helicase-nuclease activity to degrade the DNA in a 3'-5' direction.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Unknown
  • 21
    INCOMPATIBLE WITH RFC[21]
    Unknown
  • 23
    INCOMPATIBLE WITH RFC[23]
    Unknown
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 2307
    Illegal AgeI site found at 2680
  • 1000
    COMPATIBLE WITH RFC[1000]


The Wild type Cas3 gene has been cloned in Institute of Biotechnology and has unwanted EcoRI, XbaI and PstI restriction sites inside the gene.


(Figure1. Wild type Cas3 plasmid map. There are two restriction sites for each restriction enzyme all in close proximity. )


These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit. These mutagenic primers were used:

EcoRI mutagenesis : Fw: cgttttcaatggcagaatccggcatttgatttggca Rev: tgccaaatcaaatgccggattctgccattgaaaacg

XbaI Mutagenesis: Fw: cgatcatcattattcttctctggatgctgatgttaatttggg Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg

PstI Mutagenesis: Fw: gaagactgaactgcctgcggttaaacaacataaac Rev: gtttatgttgtttaaccgcaggcagttcagtcttc

First multiple mutagenesis attempt was not fully successful, because restriction analysis (Figure 2.) of mutated plasmids showed, that only two out of three restriction sites were mutated.


(Figure 2. First restriction analysis. Restriction with EcoRI (E), XbaI (X) and PstI (P) of Wild type (WT) Cas3 gene compared to mutated Cas3 genes. The first mutant plasmid has two successful mutations, whereas the second mutant plasmid only has one successfully mutated restriction site.)


Later we mutagenised the Mutant#1 plasmid, for the third PstI restriction using the same procedure as before. After plasmid restriction analysis (Figure 3) we had many successfully mutated plasmid (all except mutated plasmid #1), which later were sequenced and confirmed.


(Figure 3. Restriction analysis of Cas3 mutagenesis second run. K - undigested Wild type Cas3 plasmid. E - digested with EcoRI; X - digested with XbaI; P - digested with PstI.)