Difference between revisions of "Part:BBa K1773003:Design"
(→Design Notes) |
(→Design Notes) |
||
Line 6: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | The Wild type Cas3 gene has unwanted EcoRI, XbaI and PstI restriction sites inside the gene. | + | The Wild type Cas3 gene has been cloned in Institute of Biotechnology and has unwanted EcoRI, XbaI and PstI restriction sites inside the gene. |
− | [[File:Cas3 genolapis1.png|300px|thumb|('''Figure1. Wild type Cas3 plasmid map.''' There are two restriction sites for each restriction enzyme all in close proximity | + | [[File:Cas3 genolapis1.png|300px|thumb|('''Figure1. Wild type Cas3 plasmid map.''' There are two restriction sites for each restriction enzyme all in close proximity. )|center]] |
− | These restriction sites were mutated to make this gene biobrick compatible. First multiple mutagenesis attempt was not fully successful, because restriction analysis of mutated plasmids showed, that only two out of three restriction sites were mutated. | + | These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit. |
+ | These mutagenic primers were used: | ||
+ | |||
+ | EcoRI mutagenesis : | ||
+ | Fw: cgttttcaatggcagaatccggcatttgatttggca | ||
+ | Rev: tgccaaatcaaatgccggattctgccattgaaaacg | ||
+ | |||
+ | XbaI Mutagenesis: | ||
+ | Fw: cgatcatcattattcttctctggatgctgatgttaatttggg | ||
+ | Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg | ||
+ | |||
+ | PstI Mutagenesis: | ||
+ | Fw: gaagactgaactgcctgcggttaaacaacataaac | ||
+ | Rev: gtttatgttgtttaaccgcaggcagttcagtcttc | ||
+ | |||
+ | First multiple mutagenesis attempt was not fully successful, because restriction analysis of mutated plasmids showed, that only two out of three restriction sites were mutated. | ||
Revision as of 15:19, 9 September 2015
I-F type CRISPR-Cas Cas3 gene
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 2623
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1344
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 2307
Illegal AgeI site found at 2680 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
The Wild type Cas3 gene has been cloned in Institute of Biotechnology and has unwanted EcoRI, XbaI and PstI restriction sites inside the gene.
These restriction sites were mutated to make this gene biobrick compatible. Gene mutagenesis was performed using Invitrogen Gene-art multi site mutagenesis PLUS kit.
These mutagenic primers were used:
EcoRI mutagenesis : Fw: cgttttcaatggcagaatccggcatttgatttggca Rev: tgccaaatcaaatgccggattctgccattgaaaacg
XbaI Mutagenesis: Fw: cgatcatcattattcttctctggatgctgatgttaatttggg Rev: cccaaattaacatcagcatccagagaagaataatgatgatcg
PstI Mutagenesis: Fw: gaagactgaactgcctgcggttaaacaacataaac Rev: gtttatgttgtttaaccgcaggcagttcagtcttc
First multiple mutagenesis attempt was not fully successful, because restriction analysis of mutated plasmids showed, that only two out of three restriction sites were mutated.
Later we mutagenised the Mutant#1 plasmid, for the third PstI restriction using the same procedure as before. After plasmid restriction analysis (Figure 2) we had many successfully mutated plasmid (all except mutated plasmid #1), which later were sequenced and confirmed.
Source
A.actinomycetemcomitans D7-S