Difference between revisions of "Part:BBa K1620000"

Revision as of 17:47, 5 September 2015

Promoter element UspA

Sequence and Features

Usage and Biology

The universal stress protein A is a response of Escherichia coli cells to growth arrest, and its lacking generates cells with defective growth. For more information about this important protein, please feel free to visit the respective Wikigenes page (https://www.wikigenes.org/e/gene/e/948007.html). The universal stress protein A promoter (also as known as PuspA) is a well characterized promoter element, inducible under several stress conditions (Prytz et al. 2003; Dyk et al. 1995; Nyström and Neidhardt 1992; 1994). This genetic element is dependent to sigma-70 factor (Nyström and Neidhardt 1992; 1994). Its regulation is done through the concentration of a specific stationary phase allormone, guanosine-5'-diphosphate-3'-diphosphate (ppGp), as described elsewhere (Farewell et al. 1998b). The ppGp activate the transcription of downstream elements through a positive regulation of the β-subunit of RNA polymerase. In this sense, the PuspA element is considered a stationary phase promoter. However, in the work of Prytz et al. (2003) a constitutive transcription promotion was observed.

Diverse conditions make the Escherichia coli cell enter to stress state, like heat shocks, starvation, osmotic stress, ultraviolet light and other conditions. In these situations, the RNA polimerase sigma factors (ropS) trigger the expression of chaperones and other stress protector molecules, in order to help the cell survive. Previous works have showed the power of the element PuspA, like shown in the Table 1.

Table 1: Stress situations capable to induce the element PuspA. Response is given as a ratio of increase in signal of tested cells when compared with control cells.

Promoter Design

The force of this genetic element is important for construction of several devices, since environmental monitoring of toxic compounds to devices of triggered expression like this specific situation. We have drawn the sequence for an improved PuspA promoter from an analysis of 400bp upstream the Universal Protein A (UspA) gene in E. coli K12. First we have used the Scope tool (http://genie.dartmouth.edu/scope/), and we found the domain WWRBAM:

Figure 1: Domain WWRBAM obtained from analysis of 400pb upstream starting of UspA gene, using Scope.

This analysis indicated to us the sequence 5'-AAGCAT-3' as vital and potential component of promoter region. Restarting the analysis with Neural Network Promoter Predictor (http://www.fruitfly.org/seq_tools/promoter.html), the following sequence was obtained:

5' – TGAGTTTTCAATCACCTTTCCATCCACCTTATATTAAGCATGGAGG - 3'

This sequence has a transcription starting at bolded T and italicized the sigma factor binding sites. The confidence of the promotion activity of this sequence was estimated as 100%. Using this part attached to the iGEM prefix and suffix through polymerase chain reaction (PCR), the construction of pSB1C3 derived vector was carried out with current assembly methods, as shown below (the orientation is 5' > 3'):

Figure 2: Promoter final construct.

Interestingly, the lineages carrying these plasmids have a slow growth behavior, in comparison to cells carrying the pSB1C3 plasmid. In order to report its activity, we have fusioned the biobrick part BBa_E0840 (RBS/B0030+GFP/E0040+Terminator/B0015) downstream to our promoter making other new biobrick BBa_K1620005. This construct was used to evaluate the puspA element activity. Since the start, we observed a green color in colonies of E. coli DH5α after their growth at 37°C and posterior incubation for 16h at 4°C in lysogenic agar supplemented with chloramphenicol 10 μg/mL (LB agar plus Chloram.). These colonies were selected and passed through a confirmatory polymerase chain reaction. The best producing clone was selected and used for further experimentation and plasmid production.

GFP expression tests

Cold shock performance

The E. coli DH5α clone carrying the construct puspA::gfp was grown in 100 mL of lysogenic broth containing chloramphenicol as previously referred (LB plus chloram) in a 500 mL Erlenmeyer flask under 200 rpm at 37°C. After culture reach optical density of 0.5, a sample of 5 mL was collected for protein analysis. The remaining broth was transferred to a 4°C chamber without agitation for 16 h. The cells were harvested by centrifugation. The protein analysis was carried out through a SDS-PAGE, using normalized samples, and a GFP fluorescence reading in black Elisa plates using Viktor (Perkin-Elmer).

Figure 3: GFP expression using two constructs (BBa_K1620005 and BBa_K1620006) under cold shock. The S and I fractions refers to soluble and insoluble fractions, obtained after ultrasonic lysis followed by high speed centrifugation and pellet washes. The black arrow indicates GFP expected height in SDS-PAGE using BenchMark protein ladder (Invitrogen).

Figure 3: Lysate fluorescence of overnight expressed GFP under cold shock of two constructs (BBa_K1620005 and BBa_K1620006). The significant difference observed was evidenced through t-test at 0.05% of significance. Statistical inferences were made using GraphPad Prism v.5.0.

The SDS-PAGE revealed a similar effect of GFP production using the both tested promoters puspA and a control constitutive promoter pJ23101 (Bba_J23101). In this sense, the constitutive promotion of puspA was reinforced. But, when the fluorescence method was assessed, the fluorescence of samples obtained from puspA promotion was clearly brighter than the control promoter system. Furthermore, the protein quantities despite equivalent are not of the same qualities since the GFP bright is proportional to its folding. In this sense, we can conclude that puspA is not only constitutive in certain conditions; it is more suitable for complex folding proteins.

Osmotic shock induced by PEG 6000

kk

Test of Starving

kkk

Conclusions

KKK

References

KKK