Difference between revisions of "Part:BBa K1722005"

Line 6: Line 6:
  
 
Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis.<sup>[1]</sup> As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network<sup>[2-4]</sup> and is stimulated by changes of intracellular Ca2+ concerntration.<sup>[5-7]</sup> RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm),as in the following scheme:
 
Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis.<sup>[1]</sup> As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network<sup>[2-4]</sup> and is stimulated by changes of intracellular Ca2+ concerntration.<sup>[5-7]</sup> RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm),as in the following scheme:
https://static.igem.org/mediawiki/2015/c/c2/Rlu_%E5%85%AC%E5%BC%8F.png
+
<figure style="text-align: center">https://static.igem.org/mediawiki/2015/c/c2/Rlu_%E5%85%AC%E5%BC%8F.png
  
 
2015 SZU-iGEM construct Rlu with one codon being amber mutated and SV40, the promoter in the same plasmid to introduce Rluc into our system. This plasmid with Rluc, together with two other plasmids, are inserted into the cell. Only when the two promoters in plasmids without Rluc are activated simultanuously to express the downstream DNA sequence can Rluc being translated completely. RLUC that is produced inside the cells catalyzes a reaction with luciferin to produce light. By measuring the light intensity using Luminometer, we can tell the working efficiency of our system under different conditions.
 
2015 SZU-iGEM construct Rlu with one codon being amber mutated and SV40, the promoter in the same plasmid to introduce Rluc into our system. This plasmid with Rluc, together with two other plasmids, are inserted into the cell. Only when the two promoters in plasmids without Rluc are activated simultanuously to express the downstream DNA sequence can Rluc being translated completely. RLUC that is produced inside the cells catalyzes a reaction with luciferin to produce light. By measuring the light intensity using Luminometer, we can tell the working efficiency of our system under different conditions.

Revision as of 07:32, 3 September 2015



Rluc can express Renilla luciferase(Rluc).

Rluc can express Renilla luciferase which has become popular as a reporter enzyme for gene expression assays. Renilla luciferase(RLUC) is a blue-light emitting luciferase of marine anthozoan Renilla reniformis.[1] As a reporter gene, researchers attach it to a regulatory sequence of another gene of interest in bacteria, cell culture, animals or plants. RLUC is chosen as a reporter because the characteristic it confer on organisms expressing it is easily identified and measured. The bioluminescence of the sea pancy, is under the control of a nerve network[2-4] and is stimulated by changes of intracellular Ca2+ concerntration.[5-7] RLUC catalyzes the oxidation of coelenteramide, CO2 and light(480nm),as in the following scheme: <figure style="text-align: center">Rlu_%E5%85%AC%E5%BC%8F.png

2015 SZU-iGEM construct Rlu with one codon being amber mutated and SV40, the promoter in the same plasmid to introduce Rluc into our system. This plasmid with Rluc, together with two other plasmids, are inserted into the cell. Only when the two promoters in plasmids without Rluc are activated simultanuously to express the downstream DNA sequence can Rluc being translated completely. RLUC that is produced inside the cells catalyzes a reaction with luciferin to produce light. By measuring the light intensity using Luminometer, we can tell the working efficiency of our system under different conditions.

Sequence and Features


Assembly Compatibility:
  • 10
    INCOMPATIBLE WITH RFC[10]
    Unknown
  • 12
    INCOMPATIBLE WITH RFC[12]
    Unknown
  • 21
    INCOMPATIBLE WITH RFC[21]
    Unknown
  • 23
    INCOMPATIBLE WITH RFC[23]
    Unknown
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 547

Design Notes

We designed the following primers and amplified Rluc promoter from the vector psi-Check2:Up: CCGGAATTCTCTAGACTGGCTGCCAAGTAGTAC Down: TGCACTGCAGACTAGTTACTGCTCGTTCTT. By incorporating these primers into Rluc promoter, the promoter is flanked by the iGEM prefix and suffix after amplification.

Source

In our experiment, we got the part from Shenzhen Second People's Hospital. Additionally, we did our system's function verification in Shenzhen Second People's Hospital.

References

[1] Jongchan W, Matthew HH, Albrecht G. Structure-function studies on the active site of the coelenterazine-dependent luciferase from Renilla, Proteinscience, 17(10): 725-735

[2] G.H. Parker, Activities of colonial animals. I. Circulation of water in Renilla, J. Exptl. Zool. 31(1920):343–367.

[3] J.A.C. Nicol, Observation on luminescence in Renilla (Pennatulacea), J. Exp. Biol. 32(1955): 299–320.

[4] P.A.V. Anderson, J.F. Case, Electrical activity associated with luminescence and other colonial behaviour in the pennatulid Renilla kollikeri, Biol. Bull. 149(1975): 80–95.

[5] M.J. Cormier, K. Hori, J.M. Anderson, Bioluminescence in coelenterates, Biochim. Biophys. Acta 346(1974):137–164.

[6] J.M. Anderson, M.J. Cormier, Lumisomes: the cellular site of bioluminescence in coelenterates, J. Biol. Chem. 248(1973):2937–2943.

[7] J.M. Anderson, H. Charbonneau, M.J. Cormier, Mechanism of calcium induction of Renilla bioluminescence. Involvement of a calcium–triggered luciferin binding protein, Biochemistry 13(1974): 1195–1200.