Difference between revisions of "Part:BBa K1413002:Design"

(→‎Design Notes)
(→‎Design Notes)
 
(One intermediate revision by one other user not shown)
Line 8: Line 8:
 
===Design Notes===
 
===Design Notes===
 
<html>
 
<html>
−
This part have been engineered in order to improve the signal of GFP afer induced transcription.
+
<br/>This part have been engineered in order to improve the signal of GFP afer induced transcription.
−
It has been obtained by performing a mutation of 3 nucleotides within the sequence of RBS B0032.</br>
+
It has been obtained by performing a mutation of 3 nucleotides within the sequence of RBS B0032.
−
RBS B0032 = tca<u>cac</u>aggaaag <br/>
+
<ul>
−
New RBS (SD 001) = tca<u>agg</u>aggaaag<br/>
+
<li>RBS B0032 = tca<u>cac</u>aggaaag
−
 
+
<li>New RBS (SD 001) = tca<u>agg</u>aggaaag
 +
</ul>
 +
<br/>
 
This novel RBS sequence has been designed in accordance with the consensus Shine-Dalgarno sequence: AGGAGGUAA and allows the RNA to bind more tightly to the 16S ribosome to initiate translation.
 
This novel RBS sequence has been designed in accordance with the consensus Shine-Dalgarno sequence: AGGAGGUAA and allows the RNA to bind more tightly to the 16S ribosome to initiate translation.
−
To achieve this experiment, we designed two primers:<br/>
+
<br/><br/>To achieve this experiment, we designed two primers:
−
FW: GCGTACTAGAGTCA<u>AGG</u>AGGAAAGACTAGAATG</br>
+
<ul>
−
RV: CATTCTAGTCTTTCC<u>TCC</u>TTGACTCTAGTACGC</br>
+
<li>FW: GCGTACTAGAGTCA<u>AGG</u>AGGAAAGACTAGAATG</br>
−
We performed a PCR with one tube containing the Forward primer and a second one with the Reverse primer :</br>
+
<li>RV: CATTCTAGTCTTTCC<u>TCC</u>TTGACTCTAGTACGC</br>
−
-1µL Primer<br/>
+
</ul><br/>
−
-1µL BBa_K1413001 plasmid<br/>
+
We performed a PCR with one tube containing the Forward primer and a second one with the Reverse primer :
−
-1µL Dntp<br/>
+
<ul>
−
-0.5µL Q5 High Fidelity<br/>
+
<li>1µL Primer
−
-10µL Q5 buffer<br/>
+
<li>1µL BBa_K1413001 plasmid
−
-35.5µL H20<br/>  
+
<li>1µL dNTP
 +
<li>0.5µL Q5 High Fidelity
 +
<li>10µL Q5 buffer
 +
<li>35.5µL H20
 +
</ul><br/>
 
Each tubes will carry double strand plasmids and one of the strands is containing the mutated sequence.
 
Each tubes will carry double strand plasmids and one of the strands is containing the mutated sequence.
 
After this PCR run both PCR tubes are mixed  and the resulted mix is placed at 95°C for 1 min.
 
After this PCR run both PCR tubes are mixed  and the resulted mix is placed at 95°C for 1 min.

Latest revision as of 22:25, 2 November 2014


P0 promoter-RBS SD001-sfGFP- Terminator B0015 - Pr promoter-DmpR


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1241
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1719
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1404
    Illegal BsaI.rc site found at 1945
    Illegal SapI.rc site found at 211
    Illegal SapI.rc site found at 2602


Design Notes


This part have been engineered in order to improve the signal of GFP afer induced transcription. It has been obtained by performing a mutation of 3 nucleotides within the sequence of RBS B0032.

  • RBS B0032 = tcacacaggaaag
  • New RBS (SD 001) = tcaaggaggaaag

This novel RBS sequence has been designed in accordance with the consensus Shine-Dalgarno sequence: AGGAGGUAA and allows the RNA to bind more tightly to the 16S ribosome to initiate translation.

To achieve this experiment, we designed two primers:
  • FW: GCGTACTAGAGTCAAGGAGGAAAGACTAGAATG
  • RV: CATTCTAGTCTTTCCTCCTTGACTCTAGTACGC

We performed a PCR with one tube containing the Forward primer and a second one with the Reverse primer :
  • 1µL Primer
  • 1µL BBa_K1413001 plasmid
  • 1µL dNTP
  • 0.5µL Q5 High Fidelity
  • 10µL Q5 buffer
  • 35.5µL H20

Each tubes will carry double strand plasmids and one of the strands is containing the mutated sequence. After this PCR run both PCR tubes are mixed and the resulted mix is placed at 95°C for 1 min. This allows denaturation of double strand DNA.
When the temperature cools down, DNA re-anneal which generate double strand DNA with both strand containing the mutated sequence.
Then the sample is treated with DpnI during 2h at 37°C allowing digestion of methylated and hemimethylated DNA (methylation being only present on parental DNA that does not contain the mutation)
Thus only non methylated double strand plasmid with mutated sequence is present in the tubes.
DH5alpha competent cells were then transformed by heatshock.

Source

This part derives from BBa_K1413001.

References