Difference between revisions of "Part:BBa K1351022"

Revision as of 18:55, 30 October 2014

FsrA: Fur-regulated sRNA which binds the binding site sdhC

This part was generated with the RFC10 standard and has the following prefix and suffix:

prefix with EcoRI, NotI and XbaI:	GAATTCGCGGCCGCTTCTAGAG
suffix with SpeI, NotI and PstI:	TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Fig. 1. Predicted pairing between fsrA and the 5’-leader region of sdhC, the first gene of the sdhCAB operon.

Sequence and Features

Assembly Compatibility:

Revision as of 18:51, 30 October 2014 (view source) Roman90 (Talk \| contribs) ← Older edit		Revision as of 18:55, 30 October 2014 (view source) Roman90 (Talk \| contribs) Newer edit →
Line 22:		Line 22:


−	[[File:Background_Fig.5.png\|600px]]	+	[[File:Background_Fig.5.png\|thumb\|600px\|center\|Fig. 1. Predicted pairing between fsrA and the 5’-leader region of sdhC, the first gene of the sdhCAB operon.]]

	<!-- Add more about the biology of this part here		<!-- Add more about the biology of this part here