Difference between revisions of "Part:BBa K1351019"
 
(14 intermediate revisions by 3 users not shown)
Line 2: Line 2:
 
<partinfo>BBa_K1351019 short</partinfo>
 
<partinfo>BBa_K1351019 short</partinfo>
  
−
Artificial constructed complementary RNA which should bind the mRNA of the SdpI immunity protein in ''Bacillus subtilis'' in order to disturb the protein biosynthesis. Expected was a loss of immunity in b. subtilis against its own cannibalism toxin SdpABC over time.  
+
Artificial constructed complementary RNA which should bind the mRNA of the SdpI immunity protein [https://parts.igem.org/Part:BBa_K1351017 (BBa_K1351017)] in ''Bacillus subtilis'' in order to disturb the translation of immunity. Expected was a loss of immunity in ''B. subtilis'' against its own cannibalism toxin SDP [https://parts.igem.org/Part:BBa_K1351043 (BBa_K1351043)] over time.  
  
 +
 +
This part was generated with the RFC10 standard and has the following prefix and suffix:
 +
 +
{|
 +
|prefix with EcoRI, NotI and XbaI:
 +
|<span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>G
 +
|-
 +
|suffix with SpeI, NotI and PstI:
 +
|T<span style="color:red">ACTAGT</span>A<span style="color:green">GCGGCCG</span><span style="color:blue">CTGCAG</span>
 +
|}
 +
Sites of restriction enzymes generating compatible overhangs have the same color: <span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red.
 +
 +
This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].
 +
 +
Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]
 +
 +
 +
First results of this BioBrick are depicted in the following graph:
 +
 +
[[File:Sdpianti.JPG|600px]]
 +
 +
The graph shows growth curves of ''Bacillus subtilis'' wildtype, a ''SdpI'' deletion strain, a strain with our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351019 BBa_K1351019] as well as a strain carrying our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351017 BBa_K1351017].
 +
The results were performed with our protocoll: [https://static.igem.org/mediawiki/2014/c/c7/LMU-Munich14_Luminescence_Assay.pdf Lumi Assay] in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose.
 +
These results show that our BioBrick [https://parts.igem.org/wiki/index.php?title=Part:BBa_K1351019 BBa_K1351019] has no impact on the ''SdpI'' immunity. Expected was a decrease of immunity in late stationary phase comparible with the deletion of ''SdpI''.
 +
<br><br>
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===

Latest revision as of 17:56, 30 October 2014

Reverse complementary RNA sequence which binds the mRNA of the SdpI immunity

Artificial constructed complementary RNA which should bind the mRNA of the SdpI immunity protein (BBa_K1351017) in Bacillus subtilis in order to disturb the translation of immunity. Expected was a loss of immunity in B. subtilis against its own cannibalism toxin SDP (BBa_K1351043) over time.


This part was generated with the RFC10 standard and has the following prefix and suffix:

prefix with EcoRI, NotI and XbaI: GAATTCGCGGCCGCTTCTAGAG
suffix with SpeI, NotI and PstI: TACTAGTAGCGGCCGCTGCAG

Sites of restriction enzymes generating compatible overhangs have the same color: EcoRI and PstI in blue, NotI in green, XbaI and SpeI in red.

This part is used in the 2014 LMU-Munich iGEM project [http://2014.igem.org/Team:LMU-Munich BaKillus].

Results: [http://2014.igem.org/Team:LMU-Munich/Results LMU-2014-Results]


First results of this BioBrick are depicted in the following graph:

Sdpianti.JPG

The graph shows growth curves of Bacillus subtilis wildtype, a SdpI deletion strain, a strain with our BioBrick BBa_K1351019 as well as a strain carrying our BioBrick BBa_K1351017. The results were performed with our protocoll: Lumi Assay in MCSE and consist of three replicas of three measurements. The induction of was performed with 0.2% xylose. These results show that our BioBrick BBa_K1351019 has no impact on the SdpI immunity. Expected was a decrease of immunity in late stationary phase comparible with the deletion of SdpI.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]