Difference between revisions of "Part:BBa K1438001"

 
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K1438001 short</partinfo>
 
<partinfo>BBa_K1438001 short</partinfo>
 +
== Optimized bacterioferritin and its properties ==
 +
 +
=== Iron Storaging Protein ===
 +
Bacterioferritins are the E. coli cells natural iron storage proteins. These hollow nearly spherical protein shells detoxify the cell by sequestering excessive iron and forming Iron(III)hydroxid-oxide particels.
 +
 +
Bacterioferritin is an haem containing bacterial ferritin. Each heme is bound in a pocked formed by the interface between a pair of symmetry-related subunits [1]. However, it was investigated that these heme groups may be involved in the release of iron out of the ferritin iron core by forming an heme-mediated electron transfer to reduce immobilized Fe3+ to more soluble Fe2+.
 +
 +
We isolated this particular bacterioferritin from the probiotic strain E. coli Nissle 1917, which does have more iron aquisition systems than other well established E. coli strains. We conducted a site-directed mutagenesis to produce a haem free bacterioferritin protein [3].
 +
 +
 +
=== Bacterioferritin as a mediator for magnetism in a cell ===
 +
 +
Bacterioferritins have been investigated regarding their magnetic character since the 80s. Bfr overexpressing E. coli Nissle 1917 - a strain with a low immunogenity- were previously used in studies as biological MRI contrast agents. [4] Furthermore, the magentic character of iron loading bacterioferritins were studied by Hawkins & Williams concluding that the contamination of the bacterioferritin iron core with phosphate reduces the super paramagnetic properties significantally. [5]
 +
  
−
ATGAAAGGTGATACTAAAGTTATAAATTATCTCAACAAACTGTTGGGAAATGAGCTTGTCGCAATCAATCAGTACTTTCTTCATGCCCGGATGTTTAAAAACTGGGGTCTCAAACGTCTCAATGATGTGGAGTATCATGAATCCATTGATGAGCACAAACACGCCGATCGTTATATTGAGCGCATTCTTTTTCTGGAAGGTCTTCCAAACTTACAGGACCTGGGCAAACTGAACATTGGTGAAGATGTTGAGGAAATGCTGCGTTCTGATCTGGCACTTGAGCTGGATGGCGCGAAGAATTTGCGTGAGGCAATTGGTTATGCCGATAGCGTTCATGATTACGTCAGCCGCGATATGATGATAGAAATTTTGCGCGATGAAGAAGGCCATATCGACTGGCTGGAAACGGAACTTGATCTGATTCAGAAGATGGGACTGCAAAATTATCTGCAAGCACAGATTCGCGAAGAAGGTTAA
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 23:33, 17 October 2014

Bacterioferritin (BFR) M52H heme-deletion

Optimized bacterioferritin and its properties

Iron Storaging Protein

Bacterioferritins are the E. coli cells natural iron storage proteins. These hollow nearly spherical protein shells detoxify the cell by sequestering excessive iron and forming Iron(III)hydroxid-oxide particels.

Bacterioferritin is an haem containing bacterial ferritin. Each heme is bound in a pocked formed by the interface between a pair of symmetry-related subunits [1]. However, it was investigated that these heme groups may be involved in the release of iron out of the ferritin iron core by forming an heme-mediated electron transfer to reduce immobilized Fe3+ to more soluble Fe2+.

We isolated this particular bacterioferritin from the probiotic strain E. coli Nissle 1917, which does have more iron aquisition systems than other well established E. coli strains. We conducted a site-directed mutagenesis to produce a haem free bacterioferritin protein [3].


Bacterioferritin as a mediator for magnetism in a cell

Bacterioferritins have been investigated regarding their magnetic character since the 80s. Bfr overexpressing E. coli Nissle 1917 - a strain with a low immunogenity- were previously used in studies as biological MRI contrast agents. [4] Furthermore, the magentic character of iron loading bacterioferritins were studied by Hawkins & Williams concluding that the contamination of the bacterioferritin iron core with phosphate reduces the super paramagnetic properties significantally. [5]


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 106