Difference between revisions of "Part:BBa K1317003:Design"
m |
m |
||
(8 intermediate revisions by the same user not shown) | |||
Line 9: | Line 9: | ||
The design and in-silico cloning has been performed on Genome Compiler | The design and in-silico cloning has been performed on Genome Compiler | ||
+ | |||
+ | Consensus sequence: | ||
+ | |||
+ | In the literature we found out that the natural elastin has some repetitions, in particular the sequence VPGXG seems to be repeated. X is V, L, or A, and it represents 9% of the whole polypeptide. This particular sequence were translated with codon optimization for ''E.coli'' to produce a (VPGXG)x protein. Elastin properties were checked to see if they are still existing after cloning into bacteria to produce the recombinant protein named elastin like polypeptide (ELP). | ||
+ | |||
+ | [[file:Bdx2014_Vpgxg2.png|500px]] | ||
+ | |||
+ | ==== Cloning ==== | ||
+ | [[File:Bdx2014_ELP_design.png|600px]] | ||
+ | |||
+ | Primers to amplify the insert in the original pet44a vector: | ||
+ | |||
+ | Forward Primer : 5’ TAATACGACTCACTATAGGGGAATTGT 3’ | ||
+ | |||
+ | Reverse Primer : 5’ ATACTAGTCAGCAGGCGCGCCTGTACAGTATTC 3’ | ||
===Source=== | ===Source=== | ||
− | + | ''Homo Sapiens'' (GenBank accession number: AAC98394) | |
===References=== | ===References=== | ||
+ | |||
+ | [1] Doreen M. Floss et al. ''ELASTIN-like polypeptides revolutionize recombinant protein expression and their biomedical application.'' Trends in Biotechnology Vol.28 No.1 (PMID 19897265) | ||
+ | |||
+ | [2] Dan W. Urry ''Entropic Elastic Processes in Protein Mechanisms. I. Elastic Structure Due to an Inverse Temperature Transition and Elasticity Due to Internal Chain Dynamics.'' Journal of Protein Chemistry, Vol. 7, No.. I, 1988 | ||
+ | |||
+ | [3] Dan W. Urry. Physical ''Chemistry of Biological Free Energy Transduction As Demonstrated by Elastic Protein-Based Polymers.'' J. Phys. Chem. B 1997, 101, 11007-11028 | ||
+ | |||
+ | [4] Dan E. Meyer and Ashutosh Chilkoti. ''Purification of recombinant proteins by fusion with thermally-responsive polypeptides.'' NATURE BIOTECHNOLOGY VOL 17 NOVEMBER 1999 | ||
+ | |||
+ | [5] Trabbic-Carlson et al. (2004), ''Expression and purification of recombinant proteins from Escherichia coli: Comparison of an elastin-like polypeptide fusion with an oligohistidine fusion.'' Protein Science, 13: 3274–3284. doi: 10.1110/ps.04931604 | ||
+ | |||
+ | [6] K. Trabbic‐Carlson et al. ''Effect of protein fusion on the transition temperature of an environmentally responsive elastin‐like polypeptide: a role for surface hydrophobicity?'' Protein Engineering, Design and Selection (2004) 17 (1): 57-66. doi: 10.1093/protein/gzh006 |
Latest revision as of 21:04, 16 October 2014
CDS for Elastin like polypeptide (ELP)
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 312
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
The gene has been assembled by using overlapping oligos and Gibson assembly. The restriction site NheI has been added to get rid of the STOP codon. It is an improvement in the biobricks system, because it can be used to reassemble the coding sequence. For example in our project, another copy of the gene can be added just after the first one, so influence of the length of the final polymer on mechanical properties can be determined.
The design and in-silico cloning has been performed on Genome Compiler
Consensus sequence:
In the literature we found out that the natural elastin has some repetitions, in particular the sequence VPGXG seems to be repeated. X is V, L, or A, and it represents 9% of the whole polypeptide. This particular sequence were translated with codon optimization for E.coli to produce a (VPGXG)x protein. Elastin properties were checked to see if they are still existing after cloning into bacteria to produce the recombinant protein named elastin like polypeptide (ELP).
Cloning
Primers to amplify the insert in the original pet44a vector:
Forward Primer : 5’ TAATACGACTCACTATAGGGGAATTGT 3’
Reverse Primer : 5’ ATACTAGTCAGCAGGCGCGCCTGTACAGTATTC 3’
Source
Homo Sapiens (GenBank accession number: AAC98394)
References
[1] Doreen M. Floss et al. ELASTIN-like polypeptides revolutionize recombinant protein expression and their biomedical application. Trends in Biotechnology Vol.28 No.1 (PMID 19897265)
[2] Dan W. Urry Entropic Elastic Processes in Protein Mechanisms. I. Elastic Structure Due to an Inverse Temperature Transition and Elasticity Due to Internal Chain Dynamics. Journal of Protein Chemistry, Vol. 7, No.. I, 1988
[3] Dan W. Urry. Physical Chemistry of Biological Free Energy Transduction As Demonstrated by Elastic Protein-Based Polymers. J. Phys. Chem. B 1997, 101, 11007-11028
[4] Dan E. Meyer and Ashutosh Chilkoti. Purification of recombinant proteins by fusion with thermally-responsive polypeptides. NATURE BIOTECHNOLOGY VOL 17 NOVEMBER 1999
[5] Trabbic-Carlson et al. (2004), Expression and purification of recombinant proteins from Escherichia coli: Comparison of an elastin-like polypeptide fusion with an oligohistidine fusion. Protein Science, 13: 3274–3284. doi: 10.1110/ps.04931604
[6] K. Trabbic‐Carlson et al. Effect of protein fusion on the transition temperature of an environmentally responsive elastin‐like polypeptide: a role for surface hydrophobicity? Protein Engineering, Design and Selection (2004) 17 (1): 57-66. doi: 10.1093/protein/gzh006