Difference between revisions of "Part:BBa K1493200"

(→‎Characterization)
(→‎Characterization)
 
(4 intermediate revisions by the same user not shown)
Line 1: Line 1:
 
__NOTOC__
 
__NOTOC__
−
== Ferric regulator <i>Pfri</i> ==
+
== Ferric regulator Pfri  ==
 
<p><i>Pfri</i> was obtained from <i>Pseudomonas putida</i> KT2440, it functions as a transcription regulator that initiates transcription of genes involved in pyoverdine synthesis. Pyoverdine is a flourescent compound that is produced by <i>P.putida</i> that binds to iron (III). This gene was used in order to try to increase pyoverdine production <i>P.putida</i>. More information can be found on our <html><a href="http://2014.igem.org/Team:Wageningen_UR"> wiki</a>.</html></p>
 
<p><i>Pfri</i> was obtained from <i>Pseudomonas putida</i> KT2440, it functions as a transcription regulator that initiates transcription of genes involved in pyoverdine synthesis. Pyoverdine is a flourescent compound that is produced by <i>P.putida</i> that binds to iron (III). This gene was used in order to try to increase pyoverdine production <i>P.putida</i>. More information can be found on our <html><a href="http://2014.igem.org/Team:Wageningen_UR"> wiki</a>.</html></p>
  
Line 19: Line 19:
 
</figcaption></figure></html>
 
</figcaption></figure></html>
  
−
<p>In figure above it can be seen that the peak (400nm) of <i>Pfri</i> transforamant is higher than the peak from a <i>P.putida</i> containing an empty plasmid. </p>
+
<p>In figure 1 it can be seen that the peak (400nm) of <i>Pfri</i> transforamant is higher than the peak from a <i>P.putida</i> containing an empty plasmid. </p>
  
 
<br/>
 
<br/>
  
−
<html><figure><img src="https://static.igem.org/mediawiki/2014/4/4b/Wageningen_UR_registry_k1493200_boxplot_pyoverdine_400nm_w._error_bars.png"width="55%"/><figcaption>Fig2.Pyoverdine absorbance at 400nm with error bars,OD corrected.
+
<html><figure><img src="https://static.igem.org/mediawiki/2014/4/4b/Wageningen_UR_registry_k1493200_boxplot_pyoverdine_400nm_w._error_bars.png"width="55%"/><figcaption style="font-size:11px;font-weight:bold">Fig2.Pyoverdine absorbance at 400nm with error bars,OD corrected.
 
</figcaption></figure></html>
 
</figcaption></figure></html>
  
Line 40: Line 40:
 
<partinfo>BBa_K1493200 parameters</partinfo>
 
<partinfo>BBa_K1493200 parameters</partinfo>
 
<!-- -->
 
<!-- -->
 +
 +
===References===
 +
#Boukhalfa, H., S. D. Reilly, R. Michalczyk, S. Iyer and M. P. Neu (2006). "Iron (III) coordination properties of a pyoverdin siderophore produced by Pseudomonas putida ATCC 33015." Inorganic chemistry 45(14): 5607-5616.

Latest revision as of 14:38, 13 October 2014

Ferric regulator Pfri

Pfri was obtained from Pseudomonas putida KT2440, it functions as a transcription regulator that initiates transcription of genes involved in pyoverdine synthesis. Pyoverdine is a flourescent compound that is produced by P.putida that binds to iron (III). This gene was used in order to try to increase pyoverdine production P.putida. More information can be found on our wiki.

Cloning

Primers used for cloning:
Fw: 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCGGAACAACTATCCACAAGTAAG-3'
Rev: 5-'GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCAGGCCTGGCGACTGGC-3'
Note: These primers already include the biobrick preffix and suffix

Characterization

The biobrick was tested in a shuttle plasmid (pSEVA258, xylS-Pm was replaced by lacIq-Ptrc from pSEVA434) and was coupled behind an IPTG inducible promoter. Plasmid was transformed in P.putida KT2440. And grown in 10ml M9 minimal medium containing iron and were incubated in 30°C while shaken overnight(done in duplo's). The next morning it was noted that transformants were slightly greener than P.putida containing an empty plasmid. Pyoverdine was measured using a spectrometer with wavelengths ranging from 350-450nm (Boukhalfa, Reilly et al. 2006).

Fig1.Pyoverdine spectrum(350-400nm)OD corrected.

In figure 1 it can be seen that the peak (400nm) of Pfri transforamant is higher than the peak from a P.putida containing an empty plasmid.


Fig2.Pyoverdine absorbance at 400nm with error bars,OD corrected.

When looking only at the aborbance at 400nm (figure2), it can be seen that there is a 4 fold increase of pyoverdine production when Pfri is overexpressed in P.putida.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


References

  1. Boukhalfa, H., S. D. Reilly, R. Michalczyk, S. Iyer and M. P. Neu (2006). "Iron (III) coordination properties of a pyoverdin siderophore produced by Pseudomonas putida ATCC 33015." Inorganic chemistry 45(14): 5607-5616.