Difference between revisions of "Part:BBa K1493200"

(Characterization)
(Ferric regulator Pfri)
Line 2: Line 2:
 
== Ferric regulator <i>Pfri</i>  ==
 
== Ferric regulator <i>Pfri</i>  ==
 
<p><i>Pfri</i> was obtained from <i>Pseudomonas putida</i> KT2440, it functions as a transcription regulator that initiates transcription of genes involved in pyoverdine synthesis. Pyoverdine is a flourescent compound that is produced by <i>P.putida</i> that binds to iron (III). This gene was used in order to try to increase pyoverdine production <i>P.putida</i>. More information can be found on our <html><a href="http://2014.igem.org/Team:Wageningen_UR"> wiki</a>.</html></p>
 
<p><i>Pfri</i> was obtained from <i>Pseudomonas putida</i> KT2440, it functions as a transcription regulator that initiates transcription of genes involved in pyoverdine synthesis. Pyoverdine is a flourescent compound that is produced by <i>P.putida</i> that binds to iron (III). This gene was used in order to try to increase pyoverdine production <i>P.putida</i>. More information can be found on our <html><a href="http://2014.igem.org/Team:Wageningen_UR"> wiki</a>.</html></p>
 
  
 
===Cloning===
 
===Cloning===

Revision as of 09:16, 11 October 2014

Ferric regulator Pfri

Pfri was obtained from Pseudomonas putida KT2440, it functions as a transcription regulator that initiates transcription of genes involved in pyoverdine synthesis. Pyoverdine is a flourescent compound that is produced by P.putida that binds to iron (III). This gene was used in order to try to increase pyoverdine production P.putida. More information can be found on our wiki.

Cloning

Primers used for cloning were:
Fw: 5'-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGCGGAACAACTATCCACAAGTAAG-3'
Rev: 5-'GTTTCTTCCTGCAGCGGCCGCTACTAGTATTATTATCAGGCCTGGCGACTGGC-3'
Note: These primers already include the biobrick preffix and suffix

Charecterization

The biobrick was tested in a shuttle plasmid (SEVA) and was coupled behind an IPTG inducible promoter. Plasmid was transformed in P.putida KT2440. Cultures were inoculated in 10ml M9 minimal medium containing iron and were incubated in 30°C while shaken overnight. The next morning it was noted that transformants were greener than other cultures, those being Wildtype KT2400 and P.putida containing an empty plasmid. Pyoverdine was measured using a spectrometer with wavelengths ranging from 350-460nm. A higher peak can be seen for transformants containing an extra gene of Pfri