Difference between revisions of "Part:BBa K1352006:Experience"

(Created page with "Restriction digest + Gel electrophoresis Firgure 1; a Xba1 + HindIII restriction digest screen of recombinants. The recombinant which went on to become K1352006 is in lane 5. ...")
 
Line 1: Line 1:
−
Restriction digest + Gel electrophoresis
 
−
 
−
Firgure 1; a Xba1 + HindIII restriction digest screen of recombinants.  The recombinant which went on to become K1352006 is in lane 5.  The “L” lane is DNA marker (ladder).  The arrows are to highlight the distance travelled by the HindIII-negative recombinants.
 
  
 +
__NOTOC__
 +
This experience page is provided so that any user may enter their experience using this part.<BR>Please enter
 +
how you used this part and how it worked out.
  
 +
===Applications of BBa_K1352006===
  
−
 
+
===User Reviews===
−
+
<!-- DON'T DELETE --><partinfo>BBa_K1352006 StartReviews</partinfo>
−
Figure 2; a restriction digest verification of plasmid K1352006
+
<!-- Template for a user review
−
 
+
{|width='80%' style='border:1px solid gray'
−
For figure 2: the letters indicate the following:
+
|-
−
 
+
|width='10%'|
−
L. 10,000bp – 500bp DNA marker “ladder”
+
<partinfo>BBa_K1352006 AddReview number</partinfo>
−
 
+
<I>Username</I>
−
N. K1352006 plasmid digested with no enzymes
+
|width='60%' valign='top'|
−
 
+
Enter the review inofrmation here.
−
E. K1352006 plasmid digested with EcoRI
+
|};
−
 
+
<!-- End of the user review template -->
−
X. K1352006 plasmid digested with XbaI
+
<!-- DON'T DELETE --><partinfo>BBa_K1352006 EndReviews</partinfo>
−
 
+
−
S. K1352006 plasmid digested with SpeI
+
−
 
+
−
P. K1352006 plasmid digested with PstI
+
−
 
+
−
EP. K1352006 plasmid digested with EcoRI and PstI
+
−
 
+
−
XS. K1352006 plasmid digested with XbaI and Spe1
+
−
 
+
−
DNA Sequencing
+
−
The recombinant plasmid was Sanger-sequenced with the following sequencing primers.  “G101” is a reverse primer, the rest are forward primers.
+
−
 
+
−
“G101” (attaccgcctttgagtgagc)
+
−
 
+
−
“G100” (tgccacctgacgtctaagaa)
+
−
 
+
−
“35 INP-SEQ 1” (ccgattcattaatgcagctgg)
+
−
 
+
−
“36 INP-SEQ 2” (gaggttgctgttgccgac)
+
−
 
+
−
“37 INP-SEQ 3” (ggtgtggaagccgacattc)
+
−
 
+
−
The plasmid insert was found to be exactly as desired.  Highlighted below is the MCS excerpt from the “G101” primer results (“G101” is a reverse primer which is why the sequence is in reverse complement).
+
−
+
−
 
+
−
Conclusions
+
−
The construct sequence was produced exactly as designed; the full FLAG-tag – with BglII and HindIII sites – is present at the N-terminus of the linker sequence after INP.  However, despite all this, possibly due to YFP’s C and N termini being on the same side of it, the FLAG-tag is not accessible to antibodies.
+

Revision as of 17:49, 3 October 2014


This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K1352006

User Reviews

UNIQ6a1c18668594c016-partinfo-00000000-QINU UNIQ6a1c18668594c016-partinfo-00000001-QINU