Difference between revisions of "Part:BBa K823034"

Latest revision as of 17:05, 3 February 2014

3x FLAG tag (Freiburg standard+RBS)

3x FLAG tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html T.P. Hopp, K.S. Prickett et al. (1988)]). It consists of eight hydrophobic aminoacids: DYKDDDDK and the 3x Flag tag is: DYKDHDGDYKDHDIDYKDDDDK. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

3x Flag - tag

HA - tag

cMyc - tag

His - tag

Strep - tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox]. This part was also evaluated in the publication [http://www.jbioleng.org/content/7/1/29 The Bacillus BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with Bacillus subtilis] by Radeck et al..

Evaluation

All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in Bacillus subtils using pSB_Bs0K-P_spac. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.

Fig. 1: Western blots of N- and C-terminal fusions of each tag to GFP, using the strains TMB1920 (Flag-gfp), TMB1921 (gfp-Flag), TMB1922 (HA-gfp), TMB1923 (gfp-HA), TMB1924 (cMyc-gfp), TMB1925 (gfp-cMyc), TMB1926 (His-gfp), TMB1927 (gfp-His), TMB1928 (StrepII-gfp) and TMB1929 (gfp-StrepII). For each construct, two independent clones were tested with epitope tag- and GFP-specific antibodies as a positive control.

Methods

To verify the functionality of the epitope tags, Western blot analyses of the strains TMB1920-TMB1929 were performed. LB medium (15 ml) was inoculated 1:100 from overnight culture and grown at 37°C and 200 rpm to OD600 ~ 0.5. Of this, 10 ml were harvested by centrifugation (8000 × g, 5 min) and the pellets stored at -20°C. Pellets were resuspended in 1 ml disruption buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl) and lysed by sonication. Samples (12 μl of lysate) were loaded per lane on two 12.5% SDS-polyacrylamide gels and SDS-PAGE was performed according standard procedure [60]. One gel was stained with colloidal coomassie, the other one was used for protein transfer to a PVDF membrane (Merck Millipore, Billerica, MA, USA) by submerged blotting procedure (Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA)). After protein transfer, the membranes were treated with the following antibodies and conditions. Detailed protocols can be found [http://www.jbioleng.org/content/7/1/29/suppl/S3 here].

GFP

Probing with primary antibodies takes place with rabbit anti-GFP antibodies (1:3000, Epitomics, No. 1533). Horseradish-peroxidase (HRP)-conjugated anti-rabbit antibodies (1:2000, Promega, W401B) were used as secondary antibody. Hybridization of both antibodies was carried out in Blotto-buffer (2.5% (w/v) skim milk powder, 1 × TBS (50 mM Tris–HCl pH 7.6, 0.15 M NaCl)).

FLAG

Rabbit anti-FLAG (1:2000, Sigma, Anti-Flag polyclonal, F7425) and anti-rabbit-HRP (1:2000, Promega, W401B) were used in Blotto-buffer.

Chemiluminescence signals were detected after addition of the HRP-substrate Ace Glow (Peqlab, Erlangen, Germany) using a Fusion^TM imaging system (Peqlab).

Usage and Biology

Sequence and Features

Assembly Compatibility:

10
COMPATIBLE WITH RFC[10]
12
COMPATIBLE WITH RFC[12]
21
COMPATIBLE WITH RFC[21]
23
COMPATIBLE WITH RFC[23]
25
COMPATIBLE WITH RFC[25]
1000
COMPATIBLE WITH RFC[1000]

@@ Line 28: / Line 28: @@
-Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox].
+Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks '''''BacillusB'''''io'''B'''rick'''B'''ox]. This part was also evaluated in the publication [http://www.jbioleng.org/content/7/1/29 The ''Bacillus'' BioBrick Box: generation and evaluation of essential genetic building blocks for standardized work with ''Bacillus subtilis''] by Radeck ''et al.''.
-===Evaluation [under construction]===
+===Evaluation===
 <p align="justify">
-All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in ''Bacillus subtils'' using [https://parts.igem.org/Part:BBa_K823026 pSB<sub><i>Bs</sub></i>0K-P<sub><i>spac</sub></i>. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.
+All 5 epitope tags were fused C- and N-terminally to GFP using the NgoMIV and AgeI restriction sites. These constructs were expressed in ''Bacillus subtils'' using [https://parts.igem.org/Part:BBa_K823026 pSB<sub>Bs</sub>0K-P<sub>spac</sub>]. This vector did not need to be induced by IPTG due to a premature stop codon in the lacI gene.
-Cells were disrupted by sonification and protein extract was loaded on a 12% SDS-PAGE. Proteins were subsequently transferred to a Nitrocellulose membrane, incubated with tag- (or GFP-)specific antibodies as well as secondary antibodies couples to HRP. HRP-activity was detected with chemicals in a Luminometer.
-The detailed protocol can be found here [to be added soon].
 </p>
@@ Line 43: / Line 40: @@
 | style="width: 70%;background-color: #EBFCE4;" |
 {|
-|[[Image:LMU-Western_Blot_Tags.tif|400px|center]]
+|[[Image:LMU-Western_Blot_Tags.png|400px|center]]
 |-
 | style="width: 70%;background-color: #EBFCE4;" |
 {| style="color:black;" cellpadding="0" width="100%" cellspacing="0" border="0" align="center" style="text-align:center;"
 |style="width: 70%;background-color: #EBFCE4;" |
-<font color="#000000"; size="2"><p align="justify"> '''Fig. 1: Western Blots of all epitope tags fused to GFP. '''
+<font color="#000000"; size="2"><p align="justify"> Fig. 1: Western blots of N- and C-terminal fusions of each tag to GFP, using the strains TMB1920 (Flag-gfp), TMB1921 (gfp-Flag), TMB1922 (HA-gfp), TMB1923 (gfp-HA), TMB1924 (cMyc-gfp), TMB1925 (gfp-cMyc), TMB1926 (His-gfp), TMB1927 (gfp-His), TMB1928 (StrepII-gfp) and TMB1929 (gfp-StrepII). For each construct, two independent clones were tested with epitope tag- and GFP-specific antibodies as a positive control.
 |}
 |}
 |}
-<p align="justify">
+===Methods===
+To verify the functionality of the epitope tags, Western blot analyses of the strains TMB1920-TMB1929 were performed. LB medium (15 ml) was inoculated 1:100 from overnight culture and grown at 37°C and 200 rpm to OD600 ~ 0.5. Of this, 10 ml were harvested by centrifugation (8000 × g, 5 min) and the pellets stored at -20°C. Pellets were resuspended in 1 ml disruption buffer (50 mM Tris–HCl pH 7.5, 100 mM NaCl) and lysed by sonication. Samples (12 μl of lysate) were loaded per lane on two 12.5% SDS-polyacrylamide gels and SDS-PAGE was performed according standard procedure [60]. One gel was stained with colloidal coomassie, the other one was used for protein transfer to a PVDF membrane (Merck Millipore, Billerica, MA, USA) by submerged blotting procedure (Mini Trans-Blot Electrophoretic Transfer Cell (Bio-Rad, Hercules, CA, USA)). After protein transfer, the membranes were treated with the following antibodies and conditions. Detailed protocols can be found [http://www.jbioleng.org/content/7/1/29/suppl/S3 here].
-All clones show a usual growth behaviour. The activity of the promoters increases during transition from log to stationary phase. The maximum (t=1h) reaches from 200Lumi/OD<sub>600</sub> (promoter J23115) to a maximum of 1500 Lumi/OD<sub>600</sub> for the strongest promoter (J23101). Afterwards the activity goes down to the beginning level (t=2h). The oscillation of luminescence (Lumi/OD<sub>600</sub>) in the beginning of the curves are due to the small OD<sub>600</sub> values and do not mean high promoter activity. One clone of J23107 and J23114 shows significantly lower promoter activity. Therefore, additional clones should be measured. In comparison to all the other evaluated ''Bacillus'' promoters, these Anderson promoters showed a very low acitivity in ''B. subtilis''.</p>
+''GFP''
+Probing with primary antibodies takes place with rabbit anti-GFP antibodies (1:3000, Epitomics, No. 1533). Horseradish-peroxidase (HRP)-conjugated anti-rabbit antibodies (1:2000, Promega, W401B) were used as secondary antibody. Hybridization of both antibodies was carried out in Blotto-buffer (2.5% (w/v) skim milk powder, 1 × TBS (50 mM Tris–HCl pH 7.6, 0.15 M NaCl)).
+''FLAG''
+Rabbit anti-FLAG (1:2000, Sigma, Anti-Flag polyclonal, F7425) and anti-rabbit-HRP (1:2000, Promega, W401B) were used in Blotto-buffer.
+Chemiluminescence signals were detected after addition of the HRP-substrate Ace Glow (Peqlab, Erlangen, Germany) using a Fusion<sup>TM</sup> imaging system (Peqlab).
+</p>
 <br>
 <br>