Difference between revisions of "Part:BBa K1122702:Design"
(→Design Notes) |
|||
(7 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
− | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K1122702 short</partinfo> | <partinfo>BBa_K1122702 short</partinfo> | ||
Line 7: | Line 6: | ||
===Design Notes=== | ===Design Notes=== | ||
− | + | <h2>Cloning FbpA as a Biobrick</h2> | |
− | + | ||
− | Primers | + | The coding sequence alone of the Neisserial FbpA protein was cloned from a plasmid obtained from within the University of Edinburgh. Two forms of the protein were cloned: the full length native coding sequence FbpA1 BBa_K1122702 and the coding sequence less the putative signal peptide FbpA2 BBa_K1122703. In both cases primers were designed such that each sequence was terminated by two consecutive stop codons, and flanked with biobrick enzyme cut sites for insertion into pSB1C3. |
+ | |||
+ | <h2>Primers</h2> | ||
F1: cgcttctagatgaaaacatctatccgatacg | F1: cgcttctagatgaaaacatctatccgatacg | ||
Line 18: | Line 18: | ||
R1: atcctgcagcggccgctactagtattattatttcataccggcttgctc | R1: atcctgcagcggccgctactagtattattatttcataccggcttgctc | ||
− | Native coding sequence used as PCR template: | + | <h2>Native coding sequence used as PCR template:</h2> |
atgaaaacatctatccgatacgcactgcttgccgcagccctgaccgccgccacccccgcg | atgaaaacatctatccgatacgcactgcttgccgcagccctgaccgccgccacccccgcg | ||
Line 38: | Line 38: | ||
gccacccggctgcttgagcaagccggtatgaaataa | gccacccggctgcttgagcaagccggtatgaaataa | ||
− | Expected PCR fragment sizes: | + | <h2>Expected PCR fragment sizes:</h2> |
FbpA1 (F1+R1), Full length coding sequence 1032bp; FbpA2 (F2+R1) Coding sequence less putative signal peptide 969bp. See figure 1. | FbpA1 (F1+R1), Full length coding sequence 1032bp; FbpA2 (F2+R1) Coding sequence less putative signal peptide 969bp. See figure 1. | ||
+ | |||
+ | |||
+ | [[File:FbpAFigure1.jpg|200px|]] | ||
Figure 1. A 0.8% agarose gel: 1Kb ladder*; FbpA1 native sequence PCR product (plus minor product); FbpA2 less signal peptide PCR product. | Figure 1. A 0.8% agarose gel: 1Kb ladder*; FbpA1 native sequence PCR product (plus minor product); FbpA2 less signal peptide PCR product. | ||
The two PCR products were double digested with Xba1 and Pst1, and ligated into pSB1C3 digested with the same enzymes. The ligation mixture was transformed into E. coli JM109, and plasmid DNA minipreps were done on transformant colonies. Aliquots of these minipreps were linearised by digested EcoR1 and run on a 0.8% agarose gel. See figure 2. One miniprep of each coding sequence was then double digested with EcoR1 and PstI, in order to confirm a size difference between the two biobricks of the two coding sequence. See figure 3. In each of the gels the size represented by the bands was as expected. | The two PCR products were double digested with Xba1 and Pst1, and ligated into pSB1C3 digested with the same enzymes. The ligation mixture was transformed into E. coli JM109, and plasmid DNA minipreps were done on transformant colonies. Aliquots of these minipreps were linearised by digested EcoR1 and run on a 0.8% agarose gel. See figure 2. One miniprep of each coding sequence was then double digested with EcoR1 and PstI, in order to confirm a size difference between the two biobricks of the two coding sequence. See figure 3. In each of the gels the size represented by the bands was as expected. | ||
+ | |||
+ | |||
+ | [[File:FbpAFigure2.jpg|200px|]] | ||
Figure 2. EcoR1 single digests of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA1 colony 2; FbpA1 colony 3; FbpA2 colony 1; FbpA colony 2; --; --; 1Kb ladder*. | Figure 2. EcoR1 single digests of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA1 colony 2; FbpA1 colony 3; FbpA2 colony 1; FbpA colony 2; --; --; 1Kb ladder*. | ||
+ | |||
+ | |||
+ | [[File:FbpAFigure3.jpg|100px|]] | ||
Figure 3. EcoR1 PstI double digest of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA2 colony 2. | Figure 3. EcoR1 PstI double digest of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA2 colony 2. |
Latest revision as of 19:22, 4 October 2013
Ferric ion-binding protein (FbpA)
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NotI site found at 532
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 181
Illegal NgoMIV site found at 814 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
Cloning FbpA as a Biobrick
The coding sequence alone of the Neisserial FbpA protein was cloned from a plasmid obtained from within the University of Edinburgh. Two forms of the protein were cloned: the full length native coding sequence FbpA1 BBa_K1122702 and the coding sequence less the putative signal peptide FbpA2 BBa_K1122703. In both cases primers were designed such that each sequence was terminated by two consecutive stop codons, and flanked with biobrick enzyme cut sites for insertion into pSB1C3.
Primers
F1: cgcttctagatgaaaacatctatccgatacg
F2: cgcttctagatggacattaccgtgtacaacgg
R1: atcctgcagcggccgctactagtattattatttcataccggcttgctc
Native coding sequence used as PCR template:
atgaaaacatctatccgatacgcactgcttgccgcagccctgaccgccgccacccccgcg ctggcagacattaccgtgtacaacggccaacacaaagaagcggcacaagccgttgcagat gcctttacccgggctaccggcatcaaagtcaaactcaacagtgccaaaggcgaccagctt gccggccaaatcaaagaagaaggcagccgaagccccgccgacgtattctattccgaacaa atcccggcactcgccaccctttccgcagccaacctcctagagcccctgcccgcctccacc atcaacgaaacacgcggcaaaggcgtgccggttgccgccaaaaaagactgggtggcactg agcggacgttcgcgcgtcgtcgtttacgacacccgcaaactgtctgaaaaagatttggaa aaatccgtcctgaattacgccacgccgaaatggaaaaaccgcatcggttacgtccccact tccggcgcgttcttggaacagattgtcgccatcgtcaaactgaaaggcgaagcggccgca ttgaaatggctcaaaggcctgaaagaatacggcaagccttacgctaaaaactccgtcgcc cttcaagcggttgaaaacggcgaaatcgatgccgccctcatcaacaactactactggcac gctttcgcgcgtgaaaaaggcgtacaaaatgtccacacccgcctgaatttcgtccgccac agagatcccggcgcactcgttacctattccggcgcagccgtgttaaaatcctcccaaaac aaggatgaggcgaaaaaattcgtcgccttcctcgccggcaaggaaggacagcgcgccctg accgccgtccgtgccgaatatcctttgaatccgcacgtggtatccaccttcaatttggaa cccatcgccaagttggaagcaccccaagtgtccgccaccactgtttccgaaaaagaacac gccacccggctgcttgagcaagccggtatgaaataa
Expected PCR fragment sizes:
FbpA1 (F1+R1), Full length coding sequence 1032bp; FbpA2 (F2+R1) Coding sequence less putative signal peptide 969bp. See figure 1.
Figure 1. A 0.8% agarose gel: 1Kb ladder*; FbpA1 native sequence PCR product (plus minor product); FbpA2 less signal peptide PCR product.
The two PCR products were double digested with Xba1 and Pst1, and ligated into pSB1C3 digested with the same enzymes. The ligation mixture was transformed into E. coli JM109, and plasmid DNA minipreps were done on transformant colonies. Aliquots of these minipreps were linearised by digested EcoR1 and run on a 0.8% agarose gel. See figure 2. One miniprep of each coding sequence was then double digested with EcoR1 and PstI, in order to confirm a size difference between the two biobricks of the two coding sequence. See figure 3. In each of the gels the size represented by the bands was as expected.
Figure 2. EcoR1 single digests of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA1 colony 2; FbpA1 colony 3; FbpA2 colony 1; FbpA colony 2; --; --; 1Kb ladder*.
Figure 3. EcoR1 PstI double digest of minipreps on a 0.8% agarose gel: 1Kb ladder*; FbpA1 colony 1; FbpA2 colony 2. Plasmid DNA of each sequence (FbpA1 colony 1 BBa_K1122702 and FbpA2 colony 2 BBa_K1122703) was sent for sequencing and submitted to the parts registry.
- 1Kb ladder from New England Biolabs. DNA band sizes: 0.5, 1, 1.5, 2, 3, 4, 5, 6, 8, 10Kb.
Source
Neisseria gonorrhoeae gDNA