Difference between revisions of "Part:BBa K1122674:Design"

(References)
(Design Notes)
 
(2 intermediate revisions by the same user not shown)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
None
+
The part is based on the BBa_K173003 - the enzymatic components of this BioBrick were fused using MABEL technology. The fusion removed start codon in adhB, stop codon in pdc and the RBS inbetween.
  
 +
In order to generate fusion of pyruvate decarboxylase (''pdc'') and alcohol dehydrogense B (''adhB'') Mutagenesis with Blunt- Ended Ligation (MABEL) was used.
  
 +
A pair of primers was designed complementary with 3' end of pdc and 5' end of adhB. Figure 1 represents the MABEL process.
 +
 +
 +
[[File:bioethanol1.jpg]]
 +
 +
'''Fig1.''' Represents MABEL process used for generation of fused pdc-adhB construct. Primer sequences used: Forward: GCATCAAGCACCTTTTATATCC; Reverse: CAGCAGTTTATTCACCGGTTTAC. See appendix of the Edinburgh University 2013 iGEM team figure 1 for full details on the part sequence, primer binding sites and deleted region.
 +
 +
 +
Generated PCR product (see Fig 1.) was analysed on an agarose gel (Fig 2.):
 +
 +
[[File:bioethanol2.jpg]]
 +
 +
'''Fig 2.'''Presence of a single PCR product of correct size (app. 6000 bp) on a 0.8% agarose gel. 1kb NEB DNA ladder was used. Several replicates of the reaction were loaded on a gel.
  
 
===Source===
 
===Source===
Line 16: Line 30:
  
 
===References===
 
===References===
 +
 +
INGRAM, L. O., CONWAY, T., CLARK, D. P., SEWELL, G. W. & PRESTON, J. F. 1987. GENETIC-ENGINEERING OF ETHANOL-PRODUCTION IN ESCHERICHIA-COLI. Applied and Environmental Microbiology, 53, 2420-2425.
  
 
WANG, C., YOON, S.-H., JANG, H.-J., CHUNG, Y.-R., KIM, J.-Y., CHOI, E.-S. & KIM, S.-W. 2011. Metabolic engineering of Escherichia coli for alpha-farnesene production. Metabolic Engineering, 13, 648-655.
 
WANG, C., YOON, S.-H., JANG, H.-J., CHUNG, Y.-R., KIM, J.-Y., CHOI, E.-S. & KIM, S.-W. 2011. Metabolic engineering of Escherichia coli for alpha-farnesene production. Metabolic Engineering, 13, 648-655.

Latest revision as of 19:17, 4 October 2013


Plac+fused PDC-ADH


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 1109
    Illegal AgeI site found at 2315
  • 1000
    COMPATIBLE WITH RFC[1000]


Design Notes

The part is based on the BBa_K173003 - the enzymatic components of this BioBrick were fused using MABEL technology. The fusion removed start codon in adhB, stop codon in pdc and the RBS inbetween.

In order to generate fusion of pyruvate decarboxylase (pdc) and alcohol dehydrogense B (adhB) Mutagenesis with Blunt- Ended Ligation (MABEL) was used.

A pair of primers was designed complementary with 3' end of pdc and 5' end of adhB. Figure 1 represents the MABEL process.


Bioethanol1.jpg

Fig1. Represents MABEL process used for generation of fused pdc-adhB construct. Primer sequences used: Forward: GCATCAAGCACCTTTTATATCC; Reverse: CAGCAGTTTATTCACCGGTTTAC. See appendix of the Edinburgh University 2013 iGEM team figure 1 for full details on the part sequence, primer binding sites and deleted region.


Generated PCR product (see Fig 1.) was analysed on an agarose gel (Fig 2.):

Bioethanol2.jpg

Fig 2.Presence of a single PCR product of correct size (app. 6000 bp) on a 0.8% agarose gel. 1kb NEB DNA ladder was used. Several replicates of the reaction were loaded on a gel.

Source

Synthetic

References

INGRAM, L. O., CONWAY, T., CLARK, D. P., SEWELL, G. W. & PRESTON, J. F. 1987. GENETIC-ENGINEERING OF ETHANOL-PRODUCTION IN ESCHERICHIA-COLI. Applied and Environmental Microbiology, 53, 2420-2425.

WANG, C., YOON, S.-H., JANG, H.-J., CHUNG, Y.-R., KIM, J.-Y., CHOI, E.-S. & KIM, S.-W. 2011. Metabolic engineering of Escherichia coli for alpha-farnesene production. Metabolic Engineering, 13, 648-655.