Difference between revisions of "Part:BBa K1122673"

Revision as of 19:06, 4 October 2013

Ethanol production module

This part codes for the fusion of Pyruvate decarboxylase and Alcohol dehydrogenase from Zymomonas mobilis. Fused enzymes increase ethanol yields and enable its faster production.

Usage and Biology

Microbial production of ethanol is of great importance due to its possible application as a biofuel. Increasing ethanol yields in bacteria is potentially beneficial as those are able to utilise a wider variety of renewable, biomass-derived carbon sources compared to standard ethanol producer: Sacharomyces cerevisiae. Our goal was to increase ethanol yields using a fusion of Zymomonas mobilis pyruvate decarboxylase (Pdc) and alcohol dehydrogenase B (AdhB). Reactions catalysed by those enzymes (Figure A) enable conversion of pyruvate to ethanol.

Figure A. Ethanol is generated from pyruvate (fed into the pathway from glycolysis) via an Acetaldehyde intermediate.

We based the work on the hypotheses that flow of substrate from one enzyme to another should be facilitated in the fusion protein, and that due to this less of the toxic aldehyde intermediate should be released into the cell. Other fusion proteins were already presented to increase amounts of final product produced (Wang et al., 2011) what further encouraged us to undertake this work.

We have decided that we will perform the fusion of C terminus of Pdc to N terminus of AdhB. What could potentially generate a protein of a following structure: (figure B)

Figure B. Putative structure of a fused protein. Pdc tetramer (red) is an active state of this enzyme. C terminus of one of the members was linked to an N terminus of AdhB (blue). Presented AdhB enzyme is a dimer and just one of the monomers is linked to Pdc.

Sequence and Features

Generation of protein fusion

In order to generate fusion of pyruvate decarboxylase (pdc) and alcohol dehydrogense B (adhB) Mutagenesis with Blunt- Ended Ligation (MABEL) was used.

A pair of primers was designed complementary with 3' end of pdc and 5' end of adhB. Figure 1 represents the MABEL process.

Fig1. Represents MABEL process used for generation of fused pdc-adhB construct. Primer sequences used: Forward: GCATCAAGCACCTTTTATATCC; Reverse: CAGCAGTTTATTCACCGGTTTAC. See appendix of the Edinburgh University 2013 iGEM team figure 1 for full details on the part sequence, primer binding sites and deleted region.

Generated PCR product (see Fig 1.) was analysed on an agarose gel (Fig 2.):

Fig 2.Presence of a single PCR product of correct size (app. 6000 bp) on a 0.8% agarose gel. 1kb NEB DNA ladder was used. Several replicates of the reaction were loaded on a gel.

Evidence for presence of protein fusion

DNA level evidence

Primers were designed to amplify the region of fusion (region with deleted RBS). Those primers were used for PCR on fused and non-fused pdc and adhB.

Fig 3. 2.5% agarose gel analysing PCR product created using primers amplifying the region of putative gene fusion. As expected fusion product (first 3 lanes) is smaller than non-fusion (last 3 lanes).

The same set of primers was used for sequencing of pdc-adhB fusion construct. Obtained results indicate that the fused state was present on a DNA level:

File:Bioethanol sequencing.zip Presence of following DNA sequence: GTAAACCGGTGAATAAACTGCTGGCATCAAGCACCTTTTATATCC corresponding to reverse complement of reverse MABEL primer followed by forward MABEL primer sequences indicates that gene fusion was obtained.

Protein level evidence

In order to express fused pdc-adhB the construct was placed under the control of J33207 – IPTG inducible promoter combined with LacZ reporter. This process generated BBa_K1122674 [1]

Full grown cultures expressing pdc-adhB fusion and non-fusion were lysed and analysed on SDS-PAGE:

Fig 4. Scan of SDS-PAGE following Coomassie Brilliant Blue G250 staining. Within induced non-fusion lanes two intense bands are present (with size corresponding to pdc and adhB). Within induced fusion lanes described bands are missing and an additional band of increased size is observed. In vector only lane none of above described bands is present. To see full SDS-PAGE go to Appendix figure 2 on Edinburgh iGEM 2013 wiki

In order to present that functionality of adhB is attributed to a peptide of a different mass in fusion state than in non-fusion state a native PAGE was performed.

Fig 5. Native PAGE stained for AdhB activity. Enzymatic activity can be attributed to a peptide of an increased mass in the fusion state (left) than in non-fusion state (right). The vector only sample was loaded in-between.

Moreover, it was presented that pdc and adhB activity can be attributed to same gel band showing that fusion state was indeed obtained:

Fig 6. Native pages with adhB and pdc staining. Both activities are present in a band just below the well. Due to different acrylamide concentration used the fused protein was unable to migrate into the gel as opposed to PAGE present on figure 5.

Increased ethanol production

Graphs presented below indicate how fusion of Pdc and AdhB increase ethanol production compared to non-fusion enzymes when both are under control of pLac.

References

INGRAM, L. O., CONWAY, T., CLARK, D. P., SEWELL, G. W. & PRESTON, J. F. 1987. GENETIC-ENGINEERING OF ETHANOL-PRODUCTION IN ESCHERICHIA-COLI. Applied and Environmental Microbiology, 53, 2420-2425.

WANG, C., YOON, S.-H., JANG, H.-J., CHUNG, Y.-R., KIM, J.-Y., CHOI, E.-S. & KIM, S.-W. 2011. Metabolic engineering of Escherichia coli for alpha-farnesene production. Metabolic Engineering, 13, 648-655.