Difference between revisions of "Part:BBa K1150036"
Line 3: | Line 3: | ||
{| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right" | {| style="color:black" cellpadding="6" cellspacing="1" border="2" align="right" | ||
− | ! colspan="2" style="background:#FFBF00;"|RNAimer ( | + | ! colspan="2" style="background:#FFBF00;"|RNAimer (VEGF3 target) |
|- | |- | ||
|'''Function''' | |'''Function''' | ||
− | |Targeting | + | |Targeting VEGF3 with Cas9 |
|- | |- | ||
|'''Use in''' | |'''Use in''' | ||
Line 21: | Line 21: | ||
|} | |} | ||
− | This device can be used in combination with dCas9. It contains a DNA sequence that transcripts a crRNA that binds complementary to | + | This device can be used in combination with dCas9. It contains a DNA sequence that transcripts a crRNA that binds complementary to VEGF3 target (TTAAAAGTCGGCTGGTAGCGGGGAGGATCG). |
==Biology and Usage== | ==Biology and Usage== | ||
− | Freiburg 2013 used this plasmid to test the efficiency of target | + | Freiburg 2013 used this plasmid to test the efficiency of target VEGF3. Therefore this target was also cloned in front of a promoter, that on its part is located in front of a SEAP reporter gene. |
<span class='h3bb'> | <span class='h3bb'> |
Revision as of 13:09, 4 October 2013
uniCAS RNAimer to target VEGF1
RNAimer (VEGF3 target) | |
---|---|
Function | Targeting VEGF3 with Cas9 |
Use in | Mammalians |
RFC standard | RFC 25 |
Backbone | pSB1C3 |
Submitted by | [http://2013.igem.org/Team:Freiburg Freiburg 2013] |
This device can be used in combination with dCas9. It contains a DNA sequence that transcripts a crRNA that binds complementary to VEGF3 target (TTAAAAGTCGGCTGGTAGCGGGGAGGATCG).
Biology and Usage
Freiburg 2013 used this plasmid to test the efficiency of target VEGF3. Therefore this target was also cloned in front of a promoter, that on its part is located in front of a SEAP reporter gene.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 224
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 216
Literature