Difference between revisions of "Part:BBa K1065001:Design"

(Source)
 
(2 intermediate revisions by one other user not shown)
Line 8: Line 8:
  
 
<html>
 
<html>
The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly.<br />
+
The coding sequence was taken from <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> PK2. We firstly optimized the codons for both <I>B. subtilis</I> and <I>E. coli</I> and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly. Since this part has a promoter, only the site to create a fusion protein at the c-terminal is available.<br />
 
<br />
 
<br />
 +
Move the mouse over the sequences to see the features.
 +
<br/><br/>
 
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>
 
<span style= "color:brown" title="Prefix"><B>GAATTCGCGGCCGCTTCTAGA</B></span>TA<span style="color:purple; font-weight:bold" title="RBS">AGGAGG</span>AACTACT<b title="Start">ATG</b><span style="color:green" title="NgoMIV"><B>GCCGGC</B></span>ACC...<br/>
 
<br/>
 
<br/>
 
...TCG<span  style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span>
 
...TCG<span  style="color:red; font-weight:bold" title="AgeI">ACCGGT</span><b title="Stop">TAA</b><span style="color:blue; font-weight:bold" title="suffix">TACTAGTAGCGGCCGCTGCAG</span>
 
</html>
 
</html>
 
The AraC-pBAD promoter was taken from the UNITN iGEM 2012 team (<a href="https://parts.igem.org/wiki/index.php?title=Part:BBa_K731201">BBa_K731201</a>).
 
  
 
===Source===
 
===Source===
  
Synthesized by GenScript®.
+
AraC-pBAD used part was BBa_K731201 from UNITN-iGEM team 2012. <br>
 +
EFE CDS was synthesized by GenScript®.
 +
 
 +
Method of cloning: RFC10 (standard assembly).
  
 
===References===
 
===References===
 
<html><ol>
 
<html><ol>
<li>GOTO,M .,I SHIDAY, .,T AKIKAWAY,. & HYODOH,. (1985). Ethylene
+
<li>Goto M, Shiday I, Akitaway T, Hyodoh, (1985). Ethylene production by the Kudzu strains of <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.</li>
production by the Kudzu strains of <I>Pseudomonas syringae</I> pv. <I>phaseolicola</I> causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.</li>
+
 
<li>Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Journal of General Microbiology 137: 2281–2286.</li>
 
<li>Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Journal of General Microbiology 137: 2281–2286.</li>
 
<li>Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Biochem Biophys Res Commun 188: 826–832.</li>
 
<li>Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of <I>Pseudomonas syringae </I>pv.<I> phaseolicola</I> PK2. Biochem Biophys Res Commun 188: 826–832.</li>
<li>Fernando Guerrero, Vero´ nica Carbonell., Matteo Cossu., Danilo Correddu, Patrik R. Jones (2012) Ethylene Synthesis and Regulated Expression of
+
<li>Guerrero F, Carbonell. V., Cossu M, Correddu D, Jones PR (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in <I>Synechocystis sp.</I> PCC 6803. PLoS ONE 7(11): e50470.</li>
Recombinant Protein in <I>Synechocystis sp.</I> PCC 6803. PLoS ONE 7(11): e50470.</li>
+
 
</ol></html>
 
</ol></html>

Latest revision as of 16:53, 3 October 2013

AraC-pBAD + 2-oxoglutarate oxygenase/decarboxylase (EFE) + terminators


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1530
    Illegal BamHI site found at 1144
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1228
    Illegal AgeI site found at 979
    Illegal AgeI site found at 2281
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI site found at 961


Design Notes

The coding sequence was taken from Pseudomonas syringae pv. phaseolicola PK2. We firstly optimized the codons for both B. subtilis and E. coli and then synthesized the gene with an RBS sequence upstream of the start codon. We decided to include in the CDS two restriction sites (NgoMIV and AgeI) in order to allow people to use the Freiburg assembly. Since this part has a promoter, only the site to create a fusion protein at the c-terminal is available.

Move the mouse over the sequences to see the features.

GAATTCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGCACC...

...TCGACCGGTTAATACTAGTAGCGGCCGCTGCAG

Source

AraC-pBAD used part was BBa_K731201 from UNITN-iGEM team 2012.
EFE CDS was synthesized by GenScript®.

Method of cloning: RFC10 (standard assembly).

References

  1. Goto M, Shiday I, Akitaway T, Hyodoh, (1985). Ethylene production by the Kudzu strains of Pseudomonas syringae pv. phaseolicola causing halo blight in Pueraria lobata (Willd) Ohwi. Plant and Cell Physiology 26, 141-150.
  2. Nagahama K, Ogawa T, Fujii T, Tazaki M, Tanase S, et al. (1991) Purification and properties of an ethylene-forming enzyme from Pseudomonas syringae pv. phaseolicola PK2. Journal of General Microbiology 137: 2281–2286.
  3. Fukuda H, Ogawa T, Ishihara K, Fujii T, Nagahama K, et al. (1992) Molecular cloning in Escherichia coli, expression, and nucleotide sequence of the gene for the ethylene-forming enzyme of Pseudomonas syringae pv. phaseolicola PK2. Biochem Biophys Res Commun 188: 826–832.
  4. Guerrero F, Carbonell. V., Cossu M, Correddu D, Jones PR (2012) Ethylene Synthesis and Regulated Expression of Recombinant Protein in Synechocystis sp. PCC 6803. PLoS ONE 7(11): e50470.