Difference between revisions of "Help:BioBrick Prefix and Suffix"
| Line 12: | Line 12: | ||
==BioBrick Prefix== | ==BioBrick Prefix== | ||
The standard BioBrick prefix depends on the part that follows it. | The standard BioBrick prefix depends on the part that follows it. | ||
| − | {|width=' | + | {|width='80%' style='border:1px solid gray; margin-left:2em' |
|width='50%'| | |width='50%'| | ||
If that part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is: | If that part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is: | ||
|width='50%' valign='top'| | |width='50%' valign='top'| | ||
| − | <div style='font-family:monospace;font-size:175%;padding-left: | + | <div style='font-family:monospace;font-size:175%;padding-left:1em;'>gaattcgcggccgcttctag</div> |
|- | |- | ||
|width='50%'| | |width='50%'| | ||
Otherwise, the BioBrick prefix is: | Otherwise, the BioBrick prefix is: | ||
|width='50%'| | |width='50%'| | ||
| − | <div style='font-family:monospace;font-size:175%;padding-left: | + | <div style='font-family:monospace;font-size:175%;padding-left:1em'>gaattcgcggccgcttctagag</div> |
|} | |} | ||
| + | |||
==BioBrick Suffix== | ==BioBrick Suffix== | ||
| − | {|width=' | + | {|width='80%' style='border:1px solid gray; margin-left:2em' |
|width='50%'| | |width='50%'| | ||
The standard BioBrick suffix is always: | The standard BioBrick suffix is always: | ||
|width='50% 'valign='top'| | |width='50% 'valign='top'| | ||
| − | <div style='font-family:monospace;font-size:175%;padding-left: | + | <div style='font-family:monospace;font-size:175%;padding-left:1em'>tactagtagcggccgctgcag</div> |
|} | |} | ||
| + | |||
==BioBrick Scar== | ==BioBrick Scar== | ||
When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts. | When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts. | ||
| − | {|width=' | + | {|width='80%' style='border:1px solid gray; margin-left:2em' |
|width='50%'| | |width='50%'| | ||
If the second part starts "AT", the scar is: | If the second part starts "AT", the scar is: | ||
|width='50%' valign='top'| | |width='50%' valign='top'| | ||
| − | <div style='font-family:monospace;font-size:175%;padding-left: | + | <div style='font-family:monospace;font-size:175%;padding-left:1em;'>tactag</div> |
|- | |- | ||
|width='50%'| | |width='50%'| | ||
Otherwise, the scar is: | Otherwise, the scar is: | ||
|width='50%'| | |width='50%'| | ||
| − | <div style='font-family:monospace;font-size:175%;padding-left: | + | <div style='font-family:monospace;font-size:175%;padding-left:1em'>tactagag</div> |
|} | |} | ||
| + | |||
==Plasmid Sequences== | ==Plasmid Sequences== | ||
Revision as of 17:40, 23 July 2006
Part Sequence
The DNA sequence for parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any bases of the BioBrick Prefix or Suffix.
Plasmids (see below) and primers or tags that explicitly specify prefix or suffix bases are exceptions to this rule.
BioBrick Prefix
The standard BioBrick prefix depends on the part that follows it.
|
If that part is a coding sequence or any other part that starts "ATG", the BioBrick prefix is: |
gaattcgcggccgcttctag
|
|
Otherwise, the BioBrick prefix is: |
gaattcgcggccgcttctagag
|
BioBrick Suffix
|
The standard BioBrick suffix is always: |
tactagtagcggccgctgcag
|
BioBrick Scar
When BioBricks with these prefix and suffix sequencees are assembled, there is a "scar" between these parts.
|
If the second part starts "AT", the scar is: |
tactag
|
|
Otherwise, the scar is: |
tactagag
|
Plasmid Sequences
Since plasmids are circular pieces of DNA, the specification of the "first" base is arbitrary. Furthermore, plasmids often hold BioBrick parts, leading to a question of how the plasmid itself is defined.
In the Registry, we define the plasmid as starting with the first base of the suffix and ending with the last base of the BioBrick prefix. That definition keeps the plasmid continuous and breaks it where parts will be inserted.