Difference between revisions of "Help:BioBrick Prefix and Suffix"

Line 1: Line 1:
 
[[Image:Partinps.png]]
 
[[Image:Partinps.png]]
  
 +
==Part Sequence==
 +
 +
The sequence of BioBrick parts in the Registry starts with the first base of the part itself and ends with its last base.
 +
For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include
 +
any based of the BioBrick Prefix or Suffix.
 +
 +
Plasmids (see below) and primers or tags that explicityl specify prefix or suffix bases are exceptions to this rule.
 +
 +
==BioBrick Prefix==
 
The standard BioBrick prefix depends on the part that follows it. If the part that follows is a coding sequence
 
The standard BioBrick prefix depends on the part that follows it. If the part that follows is a coding sequence
 
or any other part that starts ATG, the prefix is:
 
or any other part that starts ATG, the prefix is:
Line 6: Line 15:
 
GAATTCGCGGCCGCTTCTAG
 
GAATTCGCGGCCGCTTCTAG
  
Otherwise, the bioBrick prefix is:
+
Otherwise, the BioBrick prefix is:
  
 
GAATTCGCGGCCGCTTCT
 
GAATTCGCGGCCGCTTCT
 +
 +
==BioBrick Suffix==
  
 
The standard BioBrick suffix is always:
 
The standard BioBrick suffix is always:
  
 
TGGATTGCGATA
 
TGGATTGCGATA
 +
 +
==Plasmid Sequences==
 +
 +
Since plasmids are circular pieces of DNA, the specification of the "first" base is arbitrary. Furthermore, plasmids often
 +
hold BioBrick parts, leading to a question of how the plasmid itself is defined.
 +
 +
In the Registry, we define the plasmid as starting with the first base of the suffix and ending with the last base of the BioBrick prefix.
 +
That definition keeps the plasmid continuous and breaks it where parts will be inserted.

Revision as of 16:19, 23 July 2006

Partinps.png

Part Sequence

The sequence of BioBrick parts in the Registry starts with the first base of the part itself and ends with its last base. For example, a protein coding sequence is like this "ATG----------TAATAA". The sequence in the Registry does not include any based of the BioBrick Prefix or Suffix.

Plasmids (see below) and primers or tags that explicityl specify prefix or suffix bases are exceptions to this rule.

BioBrick Prefix

The standard BioBrick prefix depends on the part that follows it. If the part that follows is a coding sequence or any other part that starts ATG, the prefix is:

GAATTCGCGGCCGCTTCTAG

Otherwise, the BioBrick prefix is:

GAATTCGCGGCCGCTTCT

BioBrick Suffix

The standard BioBrick suffix is always:

TGGATTGCGATA

Plasmid Sequences

Since plasmids are circular pieces of DNA, the specification of the "first" base is arbitrary. Furthermore, plasmids often hold BioBrick parts, leading to a question of how the plasmid itself is defined.

In the Registry, we define the plasmid as starting with the first base of the suffix and ending with the last base of the BioBrick prefix. That definition keeps the plasmid continuous and breaks it where parts will be inserted.