Difference between revisions of "Part:BBa K1139201:Experience"

Revision as of 05:36, 26 September 2013

PphoA-GFP-TT

1. Materials and Methods

1-1. Construction
-pSB6A1-Ptet-GFP (MG1655)… positive control
-pSB6A1-ΔP-GFP (MG1655)… negative control
-pSB6A1-PphoA-GFP (MG1655)…BBa_K1139201

The phoA promoter region of E. coli was amplified from MG1655 genomic DNA by PCR using upstream primer (5’-acgtgaattcgcggccgcttctagagaaagttaatcttttcaacagctgtcataaag -3’) and downstream primer (5’-ccgctactagtaaatacattaaaaaataaaaacaaagcgactataagtctc -3’). Amplification was carried out with the steps shown in Fig. 1.

Fig. 1. Steps for PCR of phoA promoter

1-2. Assay Protocol

• 1-2-0. Prepare MOPS minimal medium as follows (F. Neidhardt et al., 1974).
  

Also, prepare a series of phosphate concentration gradient 1 X MOPS by changing the volume of K2HPO4 (We prepared the series as 0, 10, 30, 100, 300, 1000 µM).

[Prepare MOPS minimal medium]
200 mL of 1 X MOPS is prepared as follows.

1. Mix ingredients above and adjust the pH to 7.2 with 5 M NaOH.
2. Filter sterilize. It can be stored at 4°C, for up to 1 month.
3. Before use, add carbon source (we used a final concentration of 0.1% glucose).

[10 X MOPS mixture (200 mL)] 1. Add the following to ~60 mL milliQ H2O:

2. Add 5 M KOH to a final pH of 7.4
3. Bring total volume to 88 mL
4. Make fresh FeSO4 solution and add it to the MOPS/Tricine solution:

5. Add the following solutions to the MOPS/Tricine/FeSO4 solution
(Mix in the order shown)

6. Filter sterilize with 0.2 micron filter
7. Aliquot into sterile plastic bottle and freeze at -20°C.

[Micronutrient stock (50 mL)]
Mix everything together in 40 mL autoclaved milliQ H2O, bring up total volume to 50 mL.
Store at room temperature.

• 1-2-1. Prepare overnight culture of BBa_K1139201, positive control and negative control, each in MOPS medium (including 1.32 mM K2HPO4) containing ampicillin (50 µg/mL) at 37°C.
  
• 1-2-2. Dilute the overnight cultures to an OD600 of 0.1 in fresh MOPS medium (3 mL) containing ampicillin (50 µg/mL). (→fresh cultures)
  
• 1-2-3. Incubate the fresh cultures until the observed OD600 reaches 0.4-0.6.
  
• 1-2-4. Centrifuge the cells at 6000g, 25°C, 10 minutes, wash twice with MOPS minimal medium without phosphate containing ampicillin (50 µg/mL), and then suspend in the same medium to obtain a final OD600 of 10.
  
• 1-2-5. Add 300 µL of prepared cell suspension to 2.7 mL of test solution, the series of phosphate concentration gradient 1 X MOPS, containing ampicillin (50 µg/mL)
  
• 1-2-6. Incubate the cells for 140 minutes at 26°C.
  
• 1-2-7. 1 mL of each culture was harvested by centrifugation and suspended by adding 1 mL of PBS (phosphate-buffered saline). Dilute the suspension to obtain a final OD600 of around 0.2 by PBS.
  
• 1-2-8. Dispense 600 µL of each suspension into a disposable tube through a cell strainer. Fluorescence intensity was measured with a flow cytometer of Becton, Dickinson and Company.
  

2. Results

2-1. Before inducing by phosphate concentration Fig. 2.1 shows the fluorescence intensity of the fresh cultures (the MOPS medium which contains 1.32 mM K2HPO4) incubated until the observed OD600 reached 0.4-0.6 (Assay protocol 2-2-3). phoA promoter was repressed because the MOPS medium contained 1.32 mM phosphate, which was a high concentration for phoA promoter.

Fig. 2.1. Fluorescence intensity of the fresh cultures

2-2. After inducing by phosphate concentration Fig. 2.2.1 shows the fluorescence intensity of the induced cells by phosphate concentration. Fig. 2.2.2 shows the picture of fluorescence of the induced cells. The increase in phosphate concentration repressed the phoA promoter. Especially, we saw that the phoA promoter was drastically repressed at phosphate concentrations of 100 to 300 µM.

Fig. 2.1.1 Fluorescence intensity of the induced cells

Fig. 2.1.2 Picture of fluorescence of the induced cells

3. Discussion

We confirmed that the increase in phosphate concentration repressed the phoA promoter. Compared to OUC-China’s phosphate sensor part (BBa_K737024) including phoB promoter (Fig. 3.2), our phosphate sensor part shows clearer result.

Moreover, plants are reported to be in phosphate starvation under the concentration of 1 mM (D. Hoagland et al., 1950). Our part can also sense the concentration below 1 mM. Therefore, this part will lead us to our goal to create E. coli which could increase plant growth by synthesizing several plant hormones depending on the soil environment.

Applications of BBa_K1139201

User Reviews

UNIQf5d62a634c8d4972-partinfo-00000002-QINU UNIQf5d62a634c8d4972-partinfo-00000003-QINU