Difference between revisions of "Part:BBa K786003:Design"
Rickyleung (Talk | contribs) (→Design and Construction Notes) |
Rickyleung (Talk | contribs) (→Design and Construction Notes) |
||
Line 53: | Line 53: | ||
</ol> | </ol> | ||
− | + | ||
− | + | ||
<p style="font-size:16px"><strong>Phototactic construct for orange light detection</strong> </p> | <p style="font-size:16px"><strong>Phototactic construct for orange light detection</strong> </p> | ||
<p>BBa_K786003<br /> | <p>BBa_K786003<br /> | ||
− | + | https://static.igem.org/mediawiki/2012/5/5f/Bg8.png<br /> | |
SRI was fused with HtrI with a linker peptide, where only the membrane-proximal cytoplasmic domain of the native HtrI was kept, while the cytoplasmic domains were replaced by that of Tar. Once the fusion protein was triggered, the histidine kinase (CheA) will be regulated, leading to phototactic effect. <br /> | SRI was fused with HtrI with a linker peptide, where only the membrane-proximal cytoplasmic domain of the native HtrI was kept, while the cytoplasmic domains were replaced by that of Tar. Once the fusion protein was triggered, the histidine kinase (CheA) will be regulated, leading to phototactic effect. <br /> | ||
− | + | https://static.igem.org/mediawiki/2012/5/5c/Bg9.png | |
===Source=== | ===Source=== |
Revision as of 17:00, 28 September 2012
Sensory rhodopsin I (SRI) with HtrII & Tar, sensitive to orange light
- 10INCOMPATIBLE WITH RFC[10]Illegal SpeI site found at 37
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 7
Illegal NheI site found at 30
Illegal SpeI site found at 37 - 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 785
- 23INCOMPATIBLE WITH RFC[23]Unknown
- 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 37
Illegal NgoMIV site found at 614
Illegal NgoMIV site found at 638
Illegal NgoMIV site found at 742
Illegal NgoMIV site found at 875
Illegal AgeI site found at 144
Illegal AgeI site found at 1616 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 977
Design and Construction Notes
Pfam (version 26.0) was used to predict the domain of fusion protein. Linker was refereed and modified from previous research study of SRI fusion with HtrII.
Restriction sites of HindIII and BamHI were added before and after the SRII gene respectively for two reasons. 1. Enable further integration of other peptides (e.g.: His-tag), for the construction of a larger fusion protein. (HindIII for N-terminal while, BamHI for C-terminal) 2. Enable for switching the sensory rhodopsin portion of the fusion protein. According to previous study. [2] A series of mutant sensory rhodopsins have been identified which covers a large variation of absorbing spectrum. These two restriction sites allow further switching of the sensing unit, so the light sensing system can be tuned for sensing different kinds of light source.
The speI RE site after the promoter was kept so that the constitutive promoter can be switched to strictly controlled promoters such as PTET, tetracycline-inducible promoter; PBAD, arabinose-inducible promoter.
Method of construction
Our team made use of a fast and convenient assembly method developed recently [4] to construct all of our biobricks in an effective way without the use of restriction enzymes and ligase - the direct transformation of prolonged overlap extension PCR products.
Amplification of genes
Linear fragment DNA of the insert(s) and vector were amplified from corresponding templates by using specially designed primers which can add overlapping regions (40 bps per linear DNA) onto the DNA fragments.
Prolonged overlap extension PCR
Equal molar of insert(s) and vector DNA were added into a PCR reaction mix. The POE-PCR was conducted as follows: denaturation at 98°C for 30 s; 25 cycles of denaturation at 98°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 2.5 min.
Direct Transformation
Five microliter of the prolonged overlap extension PCR products was used to transform competent cells directly.
Constructs
List of primers
Primer# primer sequence
- TGAAAGAGGAGAAATACTAGAAGCTTATGGTGGGACTTACGACCCT
- CGCCGACGCGCCGTTCGACGCGGATCCGTCGGCGACCGCAGGCGTGT
- GGATCCGCGTCGAACGGCGCGTCGGCGATGTCGCTGAACGTATCACG
- TGCGCCAGTCGGTGCGGACAACCGTCGGTGATGTGCGCAA
- CTACACTAGCACTATCAGCGTTAAAATGTTTCCCAGTTCT
- AGAACTGGGAAACATTTTAACGCTGATAGTGCTAGTGTAG
- AGGGTCGTAAGTCCCACCATAAGCTTCTAGTATTTCTCCTCTTTCA
- TCGCGGACATGAGTGACGGTTGTCCGCACCGACTGGCGCA
- TGCGCCAGTCGGTGCGGACAACCGTCACTCATGTCCGCGA
- CTACACTAGCACTATCAGCGTCAAAATGTTTCCCAGTTTG
- CAAACTGGGAAACATTTTGACGCTGATAGTGCTAGTGTAG
- TGAAAGAGGAGAAATACTAGAAGCTTATGGACGCCGTCGCAACCGC
- TGCGCCAGTCGCTTCGTGGCACCGTCACTCATGTCCGCGA
- ATTCGCGGCCGCTTCTAGAGTCCCTTGCATTTACATTTTG
- ATCTAGTATTTCTCCTCTTTAGTCCATTCTCCCCAAAAAT
- CTAAAGAGGAGAAATACTAGATGGCTTCCTCCGAAGACGT
- CAAAATGTAAATGCAAGGGACTCTAGAAGCGGCCGCGAAT
- GGAAAGAGGAGAAATACTAGATGGCCACCACCGTACAACT
- CTAATGATGATGATGATGATGCCCTTCTTTTGTCATGCCCT
- CATCATCATCATCATCATTAGTACTAGTAGCGGCCGCTGCA
- ATCTAGTATTTCTCCTCTTTCCGGACCGCAGGCTGGCTAG
Phototactic construct for orange light detection
BBa_K786003
SRI was fused with HtrI with a linker peptide, where only the membrane-proximal cytoplasmic domain of the native HtrI was kept, while the cytoplasmic domains were replaced by that of Tar. Once the fusion protein was triggered, the histidine kinase (CheA) will be regulated, leading to phototactic effect.
Source
From genomic sequence of Halobacterium Salinarum and E.coli K12.
===References===