Difference between revisions of "Part:BBa K733007:Design"
(→Design Notes) |
|||
| (5 intermediate revisions by one other user not shown) | |||
| Line 12: | Line 12: | ||
''Forward primer design:'' | ''Forward primer design:'' | ||
| − | 5’ – [17bp prefix region, including XbaI restriction site] [11bp B. subtilis consensus RBS] [22bp overlap with GFP including 3bp spacer preceding GFP start codon] – 3’ | + | 5’ – [17bp prefix region, including XbaI restriction site] [11bp ''B. subtilis'' consensus RBS] [22bp overlap with GFP including 3bp spacer preceding GFP start codon] – 3’ |
''Forward primer sequence:'' | ''Forward primer sequence:'' | ||
| Line 27: | Line 27: | ||
Following successful PCR the PCR product and pSB1C3 were digested with XbaI and PstI. The two digestion products were then ligated together. | Following successful PCR the PCR product and pSB1C3 were digested with XbaI and PstI. The two digestion products were then ligated together. | ||
| − | '''3) PCR amplification of Pveg + spoVG RBS + lytC + linker + RPMrel region using BBa_K316037 as the template.''' | + | '''3) PCR amplification of ''Pveg'' + spoVG RBS + ''lytC'' + linker + RPMrel region using BBa_K316037 as the template.''' |
''Forward primer design:'' | ''Forward primer design:'' | ||
| Line 44: | Line 44: | ||
Following successful PCR the PCR product was digested with EcoRI and SpeI, and the RBS + GFP + double terminator construct in backbone was digested with EcoRI and XbaI. The two digestion products were then ligated together. | Following successful PCR the PCR product was digested with EcoRI and SpeI, and the RBS + GFP + double terminator construct in backbone was digested with EcoRI and XbaI. The two digestion products were then ligated together. | ||
| + | |||
== '''Part Source''' == | == '''Part Source''' == | ||
| − | Pveg, spoVG (RBS), the cell wall binding domain of | + | ''Pveg'', spoVG (RBS), the cell wall binding domain of LytC and the helical linker are all components of Imperial College London's 2010 team's detection module. These components allow high expression of any tags subsequently attached to the linker on the cell wall of ''Bacillus subtilis''. |
| − | The coding sequence of the screened phage display peptide 'RPMrel' was produced via codon optimization of RPMrel's amino acid sequence for Bacillus subtilis. This amino acid sequence (n-CPIEDRPMC-c) came out of work conducted by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf Kelly & Jones (2003)] to isolate colon tumor specific binding peptides from New England Biolabs' 'PhD-CX7C' phage display peptide library. | + | The coding sequence of the screened phage display peptide 'RPMrel' was produced via codon optimization of RPMrel's amino acid sequence for ''Bacillus subtilis''. This amino acid sequence (n-CPIEDRPMC-c) came out of work conducted by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf Kelly & Jones (2003)] to isolate colon tumor specific binding peptides from New England Biolabs' 'PhD-CX7C' phage display peptide library. |
| − | The B. subtilis consensus RBS used to express GFP was originally submitted to the Registry by Cambridge University’s 2008 team. | + | The ''B. subtilis'' consensus RBS used to express GFP was originally submitted to the Registry by Cambridge University’s 2008 team. |
The GFP coding sequence used is derived from that naturally encoded in the Aequeora victoria genome and is further modified by amino acid substitution. | The GFP coding sequence used is derived from that naturally encoded in the Aequeora victoria genome and is further modified by amino acid substitution. | ||
| Line 59: | Line 60: | ||
== '''References''' == | == '''References''' == | ||
| + | |||
| + | Kelly, Kimberly A., and David A. Jones. "Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection." ''Neoplasia'' 5.5 (2003): 437-444. Print. | ||
| + | |||
| + | Yamamoto, Hiroki, Shin-ichirou Kurosawa, and Junichi Sekiguchi. "Localization of the Vegetative Cell Wall Hydrolases LytC, LytE, and LytF on the Bacillus subtilis Cell Surface and Stability of These Enzymes to Cell Wall-Bound or Extracellular Proteases." ''Journal of Bacteriology'' 185.22 (2003): 6666-6677. Print. | ||
Latest revision as of 17:23, 26 September 2012
Pveg + spoVG RBS + lytC + linker + RPMrel + consensus RBS + GFP + double terminator
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1857
Design Notes
Construction of this part in submission form was performed in the manner detailed below.
1) PCR amplification of consensus RBS + GFP + double terminator region using BBa_E0840 as the template.
Forward primer design: 5’ – [17bp prefix region, including XbaI restriction site] [11bp B. subtilis consensus RBS] [22bp overlap with GFP including 3bp spacer preceding GFP start codon] – 3’
Forward primer sequence: 5’ – CGCGGCCGCTTCTAGAGAAAGGAGGTGTTAGATGCGTAAAGGAGAAGAAC – 3’ (50bp)
Reverse primer design: 5’ – [18bp overlap with pSB1A2 plasmid downstream of suffix] – 3’
Reverse primer sequence: 5’ – TACCGCCTTTGAGTGAGC – 3’ (18bp)
2) Ligation into standard backbone pSB1C3.
Following successful PCR the PCR product and pSB1C3 were digested with XbaI and PstI. The two digestion products were then ligated together.
3) PCR amplification of Pveg + spoVG RBS + lytC + linker + RPMrel region using BBa_K316037 as the template.
Forward primer design: 5’ – [6bp cap] [20bp overlap with standard prefix] – 3’
Forward primer sequence: 5’ – GATCATGAATTCGCGGCCGCTTCTAG – 3’ (26bp)
Reverse primer design: 5' - [8bp cap] [7bp SpeI restriction site] [6bp reverse-complementary double stop codon] [27bp reverse-complementary sequence of codon optimized RPMrel] [15bp reverse-complementary overlap with linker] - 3'
Reverse primer sequence: 5’ - GTTTCTTCACTAGTATTATTAACACATCGGGCGATCTTCGATCGGACAGGCCGCGGCTTTCGC - 3’ (63bp)
4) Ligation into consensus RBS + GFP + double terminator in standard backbone (from step 2).
Following successful PCR the PCR product was digested with EcoRI and SpeI, and the RBS + GFP + double terminator construct in backbone was digested with EcoRI and XbaI. The two digestion products were then ligated together.
Part Source
Pveg, spoVG (RBS), the cell wall binding domain of LytC and the helical linker are all components of Imperial College London's 2010 team's detection module. These components allow high expression of any tags subsequently attached to the linker on the cell wall of Bacillus subtilis.
The coding sequence of the screened phage display peptide 'RPMrel' was produced via codon optimization of RPMrel's amino acid sequence for Bacillus subtilis. This amino acid sequence (n-CPIEDRPMC-c) came out of work conducted by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf Kelly & Jones (2003)] to isolate colon tumor specific binding peptides from New England Biolabs' 'PhD-CX7C' phage display peptide library.
The B. subtilis consensus RBS used to express GFP was originally submitted to the Registry by Cambridge University’s 2008 team.
The GFP coding sequence used is derived from that naturally encoded in the Aequeora victoria genome and is further modified by amino acid substitution.
Our selected termination sequence was designed by Registry staff as a combination of a pair of hairpin sequences.
References
Kelly, Kimberly A., and David A. Jones. "Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection." Neoplasia 5.5 (2003): 437-444. Print.
Yamamoto, Hiroki, Shin-ichirou Kurosawa, and Junichi Sekiguchi. "Localization of the Vegetative Cell Wall Hydrolases LytC, LytE, and LytF on the Bacillus subtilis Cell Surface and Stability of These Enzymes to Cell Wall-Bound or Extracellular Proteases." Journal of Bacteriology 185.22 (2003): 6666-6677. Print.