Difference between revisions of "Part:BBa K733007:Design"
 
(13 intermediate revisions by one other user not shown)
Line 1: Line 1:
−
'''Pveg promoter + spoVG RBS + lytC + helical linker + RPMrel peptide + consensus RBS + GFP + double terminator'''
+
<partinfo>BBa_K733007 short</partinfo>
  
−
== '''Layout''' ==
 
  
 +
<partinfo>BBa_K733007 SequenceAndFeatures</partinfo>
  
−
== '''Part Source''' ==
 
  
−
Pveg, spoVG (RBS), the cell wall binding domain of lytC and the helical linker are all components of Imperial College London's 2010 team's detection module. These components allow high expression of any tags subsequently attached to the linker on the cell wall of Bacillus subtilis.
+
== '''Design Notes''' ==
  
−
The coding sequence of the screened phage display peptide 'RPMrel' was produced via codon optimization of RPMrel's amino acid sequence for Bacillus subtilis. This amino acid sequence (n-CPIEDRPMC-c) came out of work conducted by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf Kelly & Jones (2003)] to isolate colon tumor specific binding peptides from New England Biolabs' 'PhD-CX7C' phage display peptide library.
+
Construction of this part in submission form was performed in the manner detailed below.  
  
−
The B. subtilis consensus RBS used to express GFP was originally submitted to the Registry by Cambridge University’s 2008 team.  
+
'''1) PCR amplification of consensus RBS + GFP + double terminator region using BBa_E0840 as the template.'''
  
−
The GFP coding sequence used is derived from that naturally encoded in the Aequeora victoria genome and is further modified by amino acid substitution.  
+
''Forward primer design:''
 +
5’ – [17bp prefix region, including XbaI restriction site] [11bp ''B. subtilis'' consensus RBS] [22bp overlap with GFP including 3bp spacer preceding GFP start codon] – 3’
  
−
Our selected termination sequence was designed by Registry staff as a combination of a pair of hairpin sequences.
+
''Forward primer sequence:''
 +
5’ – CGCGGCCGCTTCTAGAGAAAGGAGGTGTTAGATGCGTAAAGGAGAAGAAC – 3’ (50bp)
  
−
== '''Design Considerations''' ==
+
''Reverse primer design:''
 +
5’ – [18bp overlap with pSB1A2 plasmid downstream of suffix] – 3’
  
−
Construction of this part in submission form was performed in the roundabout manner detailed below.  
+
''Reverse primer sequence:''
 +
5’ – TACCGCCTTTGAGTGAGC – 3’ (18bp)
 +
 
 +
'''2) Ligation into standard backbone pSB1C3.'''
  
−
'''1) PCR amplification of Pveg + spoVG RBS + lytC + linker + FLAGTM region using BBa_K316037 as the template.'''  
+
Following successful PCR the PCR product and pSB1C3 were digested with XbaI and PstI. The two digestion products were then ligated together.
 +
 
 +
'''3) PCR amplification of ''Pveg'' + spoVG RBS + ''lytC'' + linker + RPMrel region using BBa_K316037 as the template.'''  
  
 
''Forward primer design:''
 
''Forward primer design:''
Line 29: Line 36:
  
 
''Reverse primer design:''
 
''Reverse primer design:''
−
5' – [8bp cap] [7bp SpeI restriction site] [6bp reverse-complementary double stop codon] [24bp reverse-complementary sequence of codon optimized FLAGTM] [15bp reverse-complementary overlap with linker] - 3'  
+
5' - [8bp cap] [7bp SpeI restriction site] [6bp reverse-complementary double stop codon] [27bp reverse-complementary sequence of codon optimized RPMrel] [15bp reverse-complementary overlap with linker] - 3'  
  
 
''Reverse primer sequence:''
 
''Reverse primer sequence:''
−
5’ – GTTTCTTCACTAGTATTATTATTTATCATCATCATCTTTATAATCGGCCGCGGCTTTCGC – 3’ (60bp)
+
5’ - GTTTCTTCACTAGTATTATTAACACATCGGGCGATCTTCGATCGGACAGGCCGCGGCTTTCGC - 3’ (63bp)
  
−
It was discovered that the transposon insAB had been inserted within the lytC coding region of the K316037 plasmid we had used for amplification. Thus it was decided to amplify a ‘safe’ copy of the 1-954bp region of lytC and the linker + FLAGTM sequence separately after which overlapping PCR would be used to join them.  
+
'''4) Ligation into consensus RBS + GFP + double terminator in standard backbone (from step 2).'''
  
−
'''2) PCR amplification of 1-954bp lytC from the B. subtilis genome.'''
+
Following successful PCR the PCR product was digested with EcoRI and SpeI, and the RBS + GFP + double terminator construct in backbone was digested with EcoRI and XbaI. The two digestion products were then ligated together.
  
−
''Forward primer design:''
 
−
5’ – [6bp cap] [7bp XbaI restriction site] [30bp overlap with lytC] – 3’
 
  
−
''Forward primer sequence:''
+
== '''Part Source''' ==
−
5’ – GATCATTCTAGAGTTGCGTTCTTATATAAAAGTCCTAACAATG – 3’ (43bp)
+
  
−
''Reverse primer design:''
+
''Pveg'', spoVG (RBS), the cell wall binding domain of LytC and the helical linker are all components of Imperial College London's 2010 team's detection module. These components allow high expression of any tags subsequently attached to the linker on the cell wall of ''Bacillus subtilis''.
−
5’ – [27bp reverse-complementary overlap with lytC] – 3’
+
  
−
''Reverse primer sequence:''
+
The coding sequence of the screened phage display peptide 'RPMrel' was produced via codon optimization of RPMrel's amino acid sequence for ''Bacillus subtilis''. This amino acid sequence (n-CPIEDRPMC-c) came out of work conducted by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf Kelly & Jones (2003)] to isolate colon tumor specific binding peptides from New England Biolabs' 'PhD-CX7C' phage display peptide library.
−
5’ – TACAACTGGATTCTTTAGCTGATTAGC – 3’ (27bp)
+
  
−
'''3) PCR amplification of linker + FLAGTM from existing construct.'''
+
The ''B. subtilis'' consensus RBS used to express GFP was originally submitted to the Registry by Cambridge University’s 2008 team.
  
−
''Forward primer design:''
+
The GFP coding sequence used is derived from that naturally encoded in the Aequeora victoria genome and is further modified by amino acid substitution.
−
5’ – [31bp overhang overlapping with lytC] [19bp overlap with linker] – 3’
+
  
−
''Forward primer sequence:''
+
Our selected termination sequence was designed by Registry staff as a combination of a pair of hairpin sequences.
−
5’ – GGTTGCTAATCAGCTAAAGAATCCAGTTGTAAGCAGAGGCTCACGCGCAC – 3’ (50bp)
+
−
 
+
−
''Reverse primer design:''
+
−
5’ – [8bp cap] [6bp BamHI restriction site] [7bp SpeI restriction site] [31bp overlap with FLAGTM and linker sequence] – 3’
+
−
 
+
−
''Reverse primer sequence:''
+
−
5’ – GTTTCTTCGGATCCACTAGTATTATTATTTATCATCATCATCTTTATAATCG – 3’ (52bp)
+
  
−
NB. This reverse primer was originally intended to allow PCR addition of a BamHI site to the 3’ end of the construct. This would allow it to be ligated into the multiple cloning site of integration vector pDG1661. That function was never pursued and the primer was recycled for use here.
 
  
−
'''4) Overlapping PCR linking products from steps 2 and 3.'''  
+
== '''References''' ==
  
−
'''5) Ligation into standard backbone pSB1C3.'''
+
Kelly, Kimberly A., and David A. Jones. "Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection." ''Neoplasia'' 5.5 (2003): 437-444. Print.
  
−
Following successful PCR the PCR product and pSB1C3 were digested with XbaI and SpeI. The two digestion products were then ligated together.
+
Yamamoto, Hiroki, Shin-ichirou Kurosawa, and Junichi Sekiguchi. "Localization of the Vegetative Cell Wall Hydrolases LytC, LytE, and LytF on the Bacillus subtilis Cell Surface and Stability of These Enzymes to Cell Wall-Bound or Extracellular Proteases." ''Journal of Bacteriology'' 185.22 (2003): 6666-6677. Print.

Latest revision as of 17:23, 26 September 2012

Pveg + spoVG RBS + lytC + linker + RPMrel + consensus RBS + GFP + double terminator



Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1857


Design Notes

Construction of this part in submission form was performed in the manner detailed below.

1) PCR amplification of consensus RBS + GFP + double terminator region using BBa_E0840 as the template.

Forward primer design: 5’ – [17bp prefix region, including XbaI restriction site] [11bp B. subtilis consensus RBS] [22bp overlap with GFP including 3bp spacer preceding GFP start codon] – 3’

Forward primer sequence: 5’ – CGCGGCCGCTTCTAGAGAAAGGAGGTGTTAGATGCGTAAAGGAGAAGAAC – 3’ (50bp)

Reverse primer design: 5’ – [18bp overlap with pSB1A2 plasmid downstream of suffix] – 3’

Reverse primer sequence: 5’ – TACCGCCTTTGAGTGAGC – 3’ (18bp)

2) Ligation into standard backbone pSB1C3.

Following successful PCR the PCR product and pSB1C3 were digested with XbaI and PstI. The two digestion products were then ligated together.

3) PCR amplification of Pveg + spoVG RBS + lytC + linker + RPMrel region using BBa_K316037 as the template.

Forward primer design: 5’ – [6bp cap] [20bp overlap with standard prefix] – 3’

Forward primer sequence: 5’ – GATCATGAATTCGCGGCCGCTTCTAG – 3’ (26bp)

Reverse primer design: 5' - [8bp cap] [7bp SpeI restriction site] [6bp reverse-complementary double stop codon] [27bp reverse-complementary sequence of codon optimized RPMrel] [15bp reverse-complementary overlap with linker] - 3'

Reverse primer sequence: 5’ - GTTTCTTCACTAGTATTATTAACACATCGGGCGATCTTCGATCGGACAGGCCGCGGCTTTCGC - 3’ (63bp)

4) Ligation into consensus RBS + GFP + double terminator in standard backbone (from step 2).

Following successful PCR the PCR product was digested with EcoRI and SpeI, and the RBS + GFP + double terminator construct in backbone was digested with EcoRI and XbaI. The two digestion products were then ligated together.


Part Source

Pveg, spoVG (RBS), the cell wall binding domain of LytC and the helical linker are all components of Imperial College London's 2010 team's detection module. These components allow high expression of any tags subsequently attached to the linker on the cell wall of Bacillus subtilis.

The coding sequence of the screened phage display peptide 'RPMrel' was produced via codon optimization of RPMrel's amino acid sequence for Bacillus subtilis. This amino acid sequence (n-CPIEDRPMC-c) came out of work conducted by [http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1550331/pdf/neo0505_0437.pdf Kelly & Jones (2003)] to isolate colon tumor specific binding peptides from New England Biolabs' 'PhD-CX7C' phage display peptide library.

The B. subtilis consensus RBS used to express GFP was originally submitted to the Registry by Cambridge University’s 2008 team.

The GFP coding sequence used is derived from that naturally encoded in the Aequeora victoria genome and is further modified by amino acid substitution.

Our selected termination sequence was designed by Registry staff as a combination of a pair of hairpin sequences.


References

Kelly, Kimberly A., and David A. Jones. "Isolation of a Colon Tumor Specific Binding Peptide Using Phage Display Selection." Neoplasia 5.5 (2003): 437-444. Print.

Yamamoto, Hiroki, Shin-ichirou Kurosawa, and Junichi Sekiguchi. "Localization of the Vegetative Cell Wall Hydrolases LytC, LytE, and LytF on the Bacillus subtilis Cell Surface and Stability of These Enzymes to Cell Wall-Bound or Extracellular Proteases." Journal of Bacteriology 185.22 (2003): 6666-6677. Print.