Difference between revisions of "Part:BBa K823037"

Revision as of 08:55, 26 September 2012

10x His-tag (Freiburg standard+RBS)

10xHis-tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

The His-tag is a metal chelating peptide ([http://www.nature.com/nbt/journal/v6/n11/full/nbt1188-1321.html Hochuli, E.; Bannwarth, W.; Döbeli, H.; Gentz, R.; Stüber, D. (1988)]) consisting of at least 6 histidins. It can therefore be used for protein purification by metal 2+ (mostly nickel or cobalt) containing columns. There are also antibodies against this tag, or nickel/cobalt containing fluorescent probes can be used for detection. Also a immobilization is possible in nickel/cobalt coated plastikware. The aminoacid sequence is:HHHHHHHHHH

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

• 3x Flag - tag

• HA - tag

• cMyc - tag

• His - tag

• Strep - tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Sequence and Features