Difference between revisions of "Part:BBa K823034"

Revision as of 08:54, 26 September 2012

3x FLAG tag (Freiburg standard+RBS)

3x FLAG tag with RBS in Freiburg standard.

Find out more about the design of our prefix with ribosome binding site.

prefix:GAATTCCGCGGCCGCTTCTAGATAAGGAGGAACTACTATGGCCGGC

suffix:ACCGGTTAATACTAGTAGCGGCCGCTGCAGT

The Flag-tag was the first epitope tag to be published ([http://www.nature.com/nbt/journal/v6/n10/full/nbt1088-1204.html T.P. Hopp, K.S. Prickett et al. (1988)]). It consists of eight hydrophobic aminoacids: DYKDDDDK and the 3x Flag tag is: DYKDHDGDYKDHDIDYKDDDDK. There are a variety of monoclonal antibodies against this tag, N-terminal as well as position insensitive.

This is a part created by the LMU-Munich 2012 team. We added five tags to the registry, all in the Freiburg standard for N-and C-terminal fusions:

• 3x Flag - tag

• HA - tag

• cMyc - tag

• His - tag

• Strep - tag

Visit our project page for more usefull parts of our [http://2012.igem.org/Team:LMU-Munich/Bacillus_BioBricks BacillusBioBrickBox].

Usage and Biology

Sequence and Features