Difference between revisions of "Part:BBa K883701:Design"

(→‎Source)
(→‎Design Notes)
Line 6: Line 6:
  
 
===Design Notes===
 
===Design Notes===
 +
 +
To be able to use the device, the counterpart of the E-coil needs to be fused to the protein that needs to be detected.
 +
 +
 +
 +
{| class="wikitable" style="text-align: center"
 +
|- style="font-style: italic"
 +
|name
 +
|sequence 
 +
|translated 
 +
|-
 +
|E-coil (present in the brick)
 +
|aagatagcggcgttgaaggagaaaatcgcagcactaaaagaaaagatagcggcgttgaaggag   
 +
|KIAALKEKIAALKEKIAALKE     
 +
|-
 +
|K-coil (counterpart)     
 +
|gaaattgcggcgctggaaaaagaaattgcggcgctggaaaaagaaattgcggcgctggaaaaa     
 +
|EIAALEKEIAALEKEIAALEK     
 +
|}
  
 
===Source===
 
===Source===

Revision as of 13:40, 25 September 2012

Status: 500 Content-type: text/html

Software error:

Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84.
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84.
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 85.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Change.pm line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Change.pm line 8.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 12.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 12.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.


Status: 500 Content-type: text/html

Software error:

Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84.
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 84.
Global symbol "$groups" requires explicit package name at /websites/parts.igem.org/cgi/lib/User.pm line 85.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/IconBar.pm line 12.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/BBWeb.pm line 9.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Change.pm line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Change.pm line 8.
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 12.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 12.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.


Design Notes

To be able to use the device, the counterpart of the E-coil needs to be fused to the protein that needs to be detected.


name sequence translated
E-coil (present in the brick) aagatagcggcgttgaaggagaaaatcgcagcactaaaagaaaagatagcggcgttgaaggag KIAALKEKIAALKEKIAALKE
K-coil (counterpart) gaaattgcggcgctggaaaaagaaattgcggcgctggaaaaagaaattgcggcgctggaaaaa EIAALEKEIAALEKEIAALEK

Source

The biobrick BBa_I13522 was used as a template for the mutations

References