Difference between revisions of "Part:BBa K883000"

 
Line 1: Line 1:
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K883000 short</partinfo>
 
<partinfo>BBa_K883000 short</partinfo>
  
 
CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in ''Escherichia coli'', these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. BBak883001) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications
 
CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in ''Escherichia coli'', these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. BBak883001) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications
 +
 +
We obtained the coding sequence in a pET28 vector from the Virology group of Wageningen UR, where Dr. Kormelink helped us by providing us with this vector. To make the sequence compatible with the Registry of Standard Biological Parts, we designed the following primers to amplify the coat protein sequence out of the pET28 vector.
 +
 +
prefix – start codon - CCMV forward primer
 +
 +
5’-GTTTCTTCGAATTCGCGGCCGCTTCTAG'''ATGGGTACAGTCGGAACAGG'''-3’
 +
 +
suffix – CCMV reverse primer
 +
 +
5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTACT'''TCACTAATACACCGGAGTGAAA'''-3’
 +
 +
the bold sequence is the sequence part that is complementairy to the CCMV part, and when other pre- or suffix are required, these parts should be included in the new primers.
 +
 +
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 15:28, 24 September 2012

CCMV wt coat protein coding

CCMV is an abriviation of the Cowpea Chlorotic Mottle Virus, one of the most studied viruses in producing Virus Like Particles (VLPs). This part is the coding sequence of the coat protein of the CCMV virus. When expressed in Escherichia coli, these coat proteins can be harvested and be assembled in vitro using the Wageningen_UR iGEM 2012 protocols (http://2012.igem.org/Team:Wageningen_UR/Protocol/StartupCCMV) . This part is provided for the iGEM community so that they can use this part to be integrated in an own expression biobrick (e.g. BBak883001) to produce these VLPs for their one own use, including but not limited to packaging, making fusion proteins to the N/C terminal. This all for to be used in a wide variety of applications. for ideas what kind of applications can be mediated with CCMV VLPs, check http://2012.igem.org/Team:Wageningen_UR/Applications

We obtained the coding sequence in a pET28 vector from the Virology group of Wageningen UR, where Dr. Kormelink helped us by providing us with this vector. To make the sequence compatible with the Registry of Standard Biological Parts, we designed the following primers to amplify the coat protein sequence out of the pET28 vector.

prefix – start codon - CCMV forward primer

5’-GTTTCTTCGAATTCGCGGCCGCTTCTAGATGGGTACAGTCGGAACAGG-3’

suffix – CCMV reverse primer

5’-GTTTCTTCCTGCAGCGGCCGCTACTAGTACTTCACTAATACACCGGAGTGAAA-3’

the bold sequence is the sequence part that is complementairy to the CCMV part, and when other pre- or suffix are required, these parts should be included in the new primers.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 142
  • 1000
    COMPATIBLE WITH RFC[1000]