Difference between revisions of "Part:BBa K733001:Design"
(→Design Notes) |
|||
| Line 1: | Line 1: | ||
| − | + | ===Design Note=== | |
| − | + | ||
| − | + | ||
| − | + | ||
| − | + | ||
We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter. | We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter. | ||
Revision as of 16:21, 22 September 2012
Design Note
We first obtain the sequence of this part from http://dbtbs.hgc.jp/. Then we design two single strand oligonucleotides (primers) and use annealing and extension to get our intended promoter.
The sequences of these two primers are: Forward primer: 5’-CATGAAGTCTCCTTGAAATCAGAAGATATTTAGGATATATTTTTCTATGGAT–3’(Prefix not shown) Reverse primer: 5’–CAATATCCCTTTTATCCATAGAAAAATATATCCTAAATATCT–3’ (Suffix not shown)
Source
Not available at this moment.