Difference between revisions of "Part:BBa K777109:Design"
(→Design Notes) |
|||
| Line 8: | Line 8: | ||
* The ''fliC'' gene contained three PstI sites and one SpeI site that had to be removed. These mutations were induced with different primers via overlap-PCR. | * The ''fliC'' gene contained three PstI sites and one SpeI site that had to be removed. These mutations were induced with different primers via overlap-PCR. | ||
* ''fliC'' was amplified from genomic DNA of ''E. coli'' DH10B via PCR using the following primers: | * ''fliC'' was amplified from genomic DNA of ''E. coli'' DH10B via PCR using the following primers: | ||
| − | ** Fwd: | + | ** Fwd: gtttcttcgaattcgcggccgcttctagatggcacaagtcattaatacc |
| − | ** Rev: | + | ** Rev: gtttcttcgaattcgcggccgcttctagttaaccctgGagcagagacagaacc <br> (the capitalized "G" induces the mutation for removal of the third PstI site) |
| − | + | ||
| − | + | ||
===Source=== | ===Source=== | ||
Revision as of 19:22, 18 September 2012
fliC
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 1224
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal AgeI site found at 301
Illegal AgeI site found at 709 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
- The fliC gene contained three PstI sites and one SpeI site that had to be removed. These mutations were induced with different primers via overlap-PCR.
- fliC was amplified from genomic DNA of E. coli DH10B via PCR using the following primers:
- Fwd: gtttcttcgaattcgcggccgcttctagatggcacaagtcattaatacc
- Rev: gtttcttcgaattcgcggccgcttctagttaaccctgGagcagagacagaacc
(the capitalized "G" induces the mutation for removal of the third PstI site)
Source
- The part was amplified from genomic DNA of E. coli str. K-12 substr. DH10B, complete genome (CP000948.1).