Difference between revisions of "Part:BBa K861100:Experience"

(→‎Applications of BBa_K861100)
(→‎Applications of BBa_K861100)
Line 4: Line 4:
  
 
===Applications of BBa_K861100===
 
===Applications of BBa_K861100===
 +
As for the genes we clone, there is no difference between E. coli str. K12 MG1655 and more available DH5we purified and amplified these genes from genome of Escherichia coli str. DH5using PCR. The primers contain the standard restriction enzyme cutting sites. The sequences of the primers used are as below.
 +
bcsA  Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG
 +
      Sense      CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG
  
 
===User Reviews===
 
===User Reviews===

Revision as of 11:36, 15 September 2012

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K861100

As for the genes we clone, there is no difference between E. coli str. K12 MG1655 and more available DH5we purified and amplified these genes from genome of Escherichia coli str. DH5using PCR. The primers contain the standard restriction enzyme cutting sites. The sequences of the primers used are as below. bcsA Antisense CCTGCAGTACTAGTATCATTGTTGAGCCAAAGCCTG 

      Sense      CGAATTCTTCTAGAGATGAGTATCCTGACCCGGTGG

User Reviews

UNIQ3f96fbe7f8ca658b-partinfo-00000000-QINU UNIQ3f96fbe7f8ca658b-partinfo-00000001-QINU