Difference between revisions of "Promoters/Catalog/B. subtilis/Repressible"
(New page: All the promoters on this page are ''B. subtilis'' promoters that are '''negatively regulated''' meaning that increased levels of at least one transcription factor (other than the sigma fa...) |
|||
| (5 intermediate revisions by 3 users not shown) | |||
| Line 1: | Line 1: | ||
| − | + | [[Image:NegativePromoter.png|right|200px]] | |
| + | The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI ''E. coli'' promoter. | ||
| + | |||
| + | In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a σ<sub>A</sub> type contitutive promoter. | ||
| + | |||
| + | <parttable>promoter_subtilis_negative_sigmaA</parttable> | ||
| + | |||
| + | <br /> | ||
| + | |||
| + | In the future, we may also find promoters builded with the σ<sub>B</sub> promoter. | ||
| + | |||
| + | <parttable>promoter_subtilis_negative_sigmaB</parttable> | ||
| + | |||
| + | <html> | ||
| + | <style> | ||
| + | #assembly_plasmid_table {margin-left:auto;margin-right:auto; border: 3px solid #444444;} | ||
| + | #assembly_plasmid_table td {background-color:#eeeeee; padding: 5px; font-size: 12px;} | ||
| + | #assembly_plasmid_table th {background-color: #aaaaaa;padding: 5px; font-size:14px;} | ||
| + | </style> | ||
| + | </html> | ||
Latest revision as of 04:49, 4 November 2011
The B. subtilis promoters of this section are said negativly regulated promoters, because they can be repressed by the expression of a third party protein. The inhibition can be released by the addition of a molecule, like for the LacI E. coli promoter.
In the following biobricks, the proposed promoters are build with the fusion of one or several operons with a σA type contitutive promoter.
| Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | Length | Doc | Status |
|---|---|---|---|---|---|---|---|
| BBa_K090501 | Gram-Positive IPTG-Inducible Promoter | . . . tggaattgtgagcggataacaattaagctt | 107 | 2054 | It's complicated | ||
| BBa_K143014 | Promoter Xyl for B.subtilis | . . . agtttgtttaaacaacaaactaataggtga | 82 | 2112 | Not in stock | ||
| BBa_K143015 | Promoter hyper-spank for B. subtilis | . . . aatgtgtgtaattgtgagcggataacaatt | 101 | 2527 | Not in stock |
In the future, we may also find promoters builded with the σB promoter.
There are no parts for this table