Difference between revisions of "Part:BBa K608101"
Juliimapril (Talk | contribs) |
Juliimapril (Talk | contribs) |
||
| (4 intermediate revisions by the same user not shown) | |||
| Line 4: | Line 4: | ||
| − | CcaR is the response regulator | + | CcaR is the response regulator of the green light receptor [https://parts.igem.org/Part:BBa_K608102 CcaS].<br/> |
It belongs to the family of OmpR regulator class. CcaR consists of an N-terminal receiver domain that can be <br/>phosphorylated by CcaS and a C-terminal DNA-binding domain that binds directly to the promoter region of cpcG2.<br/> | It belongs to the family of OmpR regulator class. CcaR consists of an N-terminal receiver domain that can be <br/>phosphorylated by CcaS and a C-terminal DNA-binding domain that binds directly to the promoter region of cpcG2.<br/> | ||
| Line 13: | Line 13: | ||
==Usage and Biology== | ==Usage and Biology== | ||
| − | when we amplified CcaR from the whole Synechocystis genome via PCR, <br/> the primer had an overhang | + | when we amplified CcaR from the whole ''Synechocystis'' genome via PCR, <br/> the primer had an overhang with a Ribosome Binding Site.<br/> |
| − | If you want to use it | + | If you want to use it you can clone it behind a promotor of choice. |
<br/> | <br/> | ||
| + | |||
| + | The promoter region used by J.J. Tabor et. al (2010)<br/> | ||
| + | is a 238 bp long sequence upstream of the naitve output product ''cpcG''<br/> | ||
| + | unfortunately we could not clone this part into an iGEM vector on time.<br/> | ||
| + | <br/> | ||
| + | To complete information for the green light system here is the sequence for the promoter region:<br/> | ||
| + | |||
| + | PcpcG2 <br/> | ||
| + | agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgtt gcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttc aattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaactt ttaagtttaattactaactttatct | ||
| + | <br/> | ||
| + | |||
| + | |||
<!-- --> | <!-- --> | ||
<span class='h3bb'>Sequence and Features</span> | <span class='h3bb'>Sequence and Features</span> | ||
Latest revision as of 03:44, 22 September 2011
CcaR, green light response regulator
CcaR is the response regulator of the green light receptor CcaS.
It belongs to the family of OmpR regulator class. CcaR consists of an N-terminal receiver domain that can be
phosphorylated by CcaS and a C-terminal DNA-binding domain that binds directly to the promoter region of cpcG2.
Usage and Biology
when we amplified CcaR from the whole Synechocystis genome via PCR,
the primer had an overhang with a Ribosome Binding Site.
If you want to use it you can clone it behind a promotor of choice.
The promoter region used by J.J. Tabor et. al (2010)
is a 238 bp long sequence upstream of the naitve output product cpcG
unfortunately we could not clone this part into an iGEM vector on time.
To complete information for the green light system here is the sequence for the promoter region:
PcpcG2
agcccattgtgcttttctctatcaacctcagcttacctgaaggggtgaacaggtctgggttaattcatgtt gcgaaatgtaacagttttagtcgcatcagctaactttccgatttctttacgattttctcccccttttcttc aattttactttgttaggatcgcatttttaatgccaacacataccagttattggctggacattaaacaactt ttaagtttaattactaactttatct
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 380
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]